Glyma02g12220 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma02g12220

Feature Type:	gene_model
Chromosome:	Gm02
Start:	10443571
stop:	10445593
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma02g12220

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G69490	AT	Annotation by Michelle Graham. TAIR10: NAC-like, activated by AP3/PI \| chr1:26122233-26123222 FORWARD LENGTH=268	SoyBase	E_val: 3.00E-112	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0007275	GO-bp	Annotation by Michelle Graham. GO Biological Process: multicellular organismal development	SoyBase	N/A	ISS
GO:0009617	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to bacterium	SoyBase	N/A	ISS
GO:0009825	GO-bp	Annotation by Michelle Graham. GO Biological Process: multidimensional cell growth	SoyBase	N/A	ISS
GO:0009908	GO-bp	Annotation by Michelle Graham. GO Biological Process: flower development	SoyBase	N/A	ISS
GO:0010150	GO-bp	Annotation by Michelle Graham. GO Biological Process: leaf senescence	SoyBase	N/A	ISS
GO:0045087	GO-bp	Annotation by Michelle Graham. GO Biological Process: innate immune response	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003677	GO-mf	Annotation by Michelle Graham. GO Molecular Function: DNA binding	SoyBase	N/A	ISS
GO:0003700	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity	SoyBase	N/A	ISS
PF02365	PFAM	No apical meristem (NAM) protein	JGI		ISS
UniRef100_B2ZGR6	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: NAC domain protein n=1 Tax=Glycine max RepID=B2ZGR6_SOYBN	SoyBase	E_val: 0	ISS
UniRef100_B2ZGR6	UniRef	Annotation by Michelle Graham. Best UniRef hit: NAC domain protein n=1 Tax=Glycine max RepID=B2ZGR6_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma02g12220

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma02g12220

Paralog	Evidence	Comments
Glyma01g06150	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma02g12220 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.02g109800	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma02g12220

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma02g12220

Limit To All Plant Sequences

>Glyma02g12220.1   sequence type=CDS   gene model=Glyma02g12220   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGAACAGAACAAGCTCTGTACTCCCACCTGGCTTCAGGTTTCATCCCACTGATGAAGAACTAATTGTTTACTATCTTTGCAACCAAGCCACATCAAGACCATGCCCTGCATCAATCATCCCAGAAGTGGATATCTATAAGTTTGATCCATGGGAATTACCTGAAAAAACAGACTTTGGAGAAAAGGAGTGGTACTTCTTTAGTCCACGAGAGAGGAAGTATCCAAATGGGGTGAGGCCTAATAGAGCAACCGTGTCTGGGTATTGGAAGGCCACTGGCACAGATAAAGCAATCTATAGTGGGTCTAAGCATGTAGGGGTGAAGAAGGCTTTGGTTTTTTATAAGGGTAAGCCACCAAAGGGTCTCAAGACAGATTGGATTATGCATGAGTATAGATTAATTGGATCAAGAAGACAAGCCAATAGACAAGTTGGATCCATGAGGCTAGACGACTGGGTCTTGTGTAGGATCTACAAGAAGAAGAACATTGGAAAGTCAATGGAGGCAAAAGAGGAATACCCAATAGCCCAAATCAATCTTACACCAGCAAACAATGACAGTGAACAAGAAATGGTGAAATTTCCAAGGACTAGTTCCCTTACTCATCTTTTGGAAATGGATTACTTGGGTCCAATATCACATATATTATCTGATGCCACATACAATTCAACCTTTGATTTTCAAATTAACACTGCCAATGGTGGAATAGACCCGTTCGTAAAACCACAGCCGGTTGAAATCCCTTATGCAGCAGATTCAGGGAAGTACCAAGTGAAACAAAATAGCACCATCAACCCCACCATATTTGTGAACCAAGTGTATTATCAAAGAGGATAA

Predicted protein sequences of Glyma02g12220

Limit To All Plant Sequences

>Glyma02g12220.1   sequence type=predicted peptide   gene model=Glyma02g12220   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MENRTSSVLPPGFRFHPTDEELIVYYLCNQATSRPCPASIIPEVDIYKFDPWELPEKTDFGEKEWYFFSPRERKYPNGVRPNRATVSGYWKATGTDKAIYSGSKHVGVKKALVFYKGKPPKGLKTDWIMHEYRLIGSRRQANRQVGSMRLDDWVLCRIYKKKNIGKSMEAKEEYPIAQINLTPANNDSEQEMVKFPRTSSLTHLLEMDYLGPISHILSDATYNSTFDFQINTANGGIDPFVKPQPVEIPYAADSGKYQVKQNSTINPTIFVNQVYYQRG*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain