Glyma02g12140 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma02g12140

Feature Type:	gene_model
Chromosome:	Gm02
Start:	10367091
stop:	10369542
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma02g12140

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G69530	AT	Annotation by Michelle Graham. TAIR10: expansin A1 \| chr1:26142034-26143051 FORWARD LENGTH=250	SoyBase	E_val: 6.00E-151	ISS
GO:0006949	GO-bp	Annotation by Michelle Graham. GO Biological Process: syncytium formation	SoyBase	N/A	ISS
GO:0009664	GO-bp	Annotation by Michelle Graham. GO Biological Process: plant-type cell wall organization	SoyBase	N/A	ISS
GO:0009739	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to gibberellin stimulus	SoyBase	N/A	ISS
GO:0009826	GO-bp	Annotation by Michelle Graham. GO Biological Process: unidimensional cell growth	SoyBase	N/A	ISS
GO:0009828	GO-bp	Annotation by Michelle Graham. GO Biological Process: plant-type cell wall loosening	SoyBase	N/A	ISS
GO:0010114	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to red light	SoyBase	N/A	ISS
GO:0010119	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of stomatal movement	SoyBase	N/A	ISS
GO:0005576	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: extracellular region	SoyBase	N/A	ISS
GO:0009505	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plant-type cell wall	SoyBase	N/A	ISS
PF01357	PFAM	Pollen allergen	JGI		ISS
PF03330	PFAM	Rare lipoprotein A (RlpA)-like double-psi beta-barrel	JGI		ISS
UniRef100_C6TN48	UniRef	Annotation by Michelle Graham. Best UniRef hit: Expansin A4 n=1 Tax=Glycine max RepID=C6TN48_SOYBN	SoyBase	E_val: 0	ISS
UniRef100_C6TN48	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Expansin A4 n=1 Tax=Glycine max RepID=C6TN48_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma02g12140

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma02g12140

Paralog	Evidence	Comments
Glyma01g06030	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma02g12140 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.02g109100	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma02g12140

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma02g12140

Limit To All Plant Sequences

>Glyma02g12140.1   sequence type=CDS   gene model=Glyma02g12140   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTCAAATTTGTTTGCTCTTGGTGGGGCTTCTCTCAATGTTCTCCTCTGCCTATGGCTACGGATATGGTGGTGGCTGGGTTAATGCACATGCCACCTTCTATGGAGGAAGTGATGCCTCAGGAACAATGGGTGGGGCATGTGGATATGGAAACCTCTACAGCCAAGGTTATGGAACAAATACTGCTGCTTTGAGCACTGCTTTGTTCAACAATGGTCTTAGTTGTGGCTCATGCTATGAGATAAGGTGTGTGAATGACCATAGGTGGTGCCTCCCTGGCTCCATTATGGTCACTGCCACCAATTTCTGTCCTCCAAACAATGCTTTACCAAACAATGCAGGAGGGTGGTGCAACCCTCCAATGCACCATTTTGACCTCTCTCAACCTGTTTTCCTTCGCATTGCACAATACAGAGCAGGAATTGTGCCTGTTTCCTACAGAAGGGTACCCTGCAGGAGAAGGGGAGGCATAAGGTTCACAATCAATGGCCACTCCTACTTCAACTTGGTCCTCATAACAAACGTAGGAGGTGCTGGGGATGTTCATGGTGTGGCCATCAAGGGGTCAAGAACAGGGTGGATGCCAATGTCCAGAAACTGGGGTCAAAATTGGCAAAGCAACAACTATCTCAATGGCCAAAGCCTCTCATTCAAGGTCACAACCAGTGATGGCCGTACAGCTGTGTCCTACAATGTTGCCCCTGCTGGTTGGTCCTTTGGCCAAACCTACACTGGTGCTCAATTCCGCTAG

Predicted protein sequences of Glyma02g12140

Limit To All Plant Sequences

>Glyma02g12140.1   sequence type=predicted peptide   gene model=Glyma02g12140   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAQICLLLVGLLSMFSSAYGYGYGGGWVNAHATFYGGSDASGTMGGACGYGNLYSQGYGTNTAALSTALFNNGLSCGSCYEIRCVNDHRWCLPGSIMVTATNFCPPNNALPNNAGGWCNPPMHHFDLSQPVFLRIAQYRAGIVPVSYRRVPCRRRGGIRFTINGHSYFNLVLITNVGGAGDVHGVAIKGSRTGWMPMSRNWGQNWQSNNYLNGQSLSFKVTTSDGRTAVSYNVAPAGWSFGQTYTGAQFR*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain