SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma02g12140

Feature Type:gene_model
Chromosome:Gm02
Start:10367091
stop:10369542
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G69530AT Annotation by Michelle Graham. TAIR10: expansin A1 | chr1:26142034-26143051 FORWARD LENGTH=250 SoyBaseE_val: 6.00E-151ISS
GO:0006949GO-bp Annotation by Michelle Graham. GO Biological Process: syncytium formation SoyBaseN/AISS
GO:0009664GO-bp Annotation by Michelle Graham. GO Biological Process: plant-type cell wall organization SoyBaseN/AISS
GO:0009739GO-bp Annotation by Michelle Graham. GO Biological Process: response to gibberellin stimulus SoyBaseN/AISS
GO:0009826GO-bp Annotation by Michelle Graham. GO Biological Process: unidimensional cell growth SoyBaseN/AISS
GO:0009828GO-bp Annotation by Michelle Graham. GO Biological Process: plant-type cell wall loosening SoyBaseN/AISS
GO:0010114GO-bp Annotation by Michelle Graham. GO Biological Process: response to red light SoyBaseN/AISS
GO:0010119GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of stomatal movement SoyBaseN/AISS
GO:0005576GO-cc Annotation by Michelle Graham. GO Cellular Compartment: extracellular region SoyBaseN/AISS
GO:0009505GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plant-type cell wall SoyBaseN/AISS
PF01357PFAM Pollen allergen JGI ISS
PF03330PFAM Rare lipoprotein A (RlpA)-like double-psi beta-barrel JGI ISS
UniRef100_C6TN48UniRef Annotation by Michelle Graham. Best UniRef hit: Expansin A4 n=1 Tax=Glycine max RepID=C6TN48_SOYBN SoyBaseE_val: 0ISS
UniRef100_C6TN48UniRef Annotation by Michelle Graham. Most informative UniRef hit: Expansin A4 n=1 Tax=Glycine max RepID=C6TN48_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma01g06030 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.02g109100 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma02g12140.1   sequence type=CDS   gene model=Glyma02g12140   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTCAAATTTGTTTGCTCTTGGTGGGGCTTCTCTCAATGTTCTCCTCTGCCTATGGCTACGGATATGGTGGTGGCTGGGTTAATGCACATGCCACCTTCTATGGAGGAAGTGATGCCTCAGGAACAATGGGTGGGGCATGTGGATATGGAAACCTCTACAGCCAAGGTTATGGAACAAATACTGCTGCTTTGAGCACTGCTTTGTTCAACAATGGTCTTAGTTGTGGCTCATGCTATGAGATAAGGTGTGTGAATGACCATAGGTGGTGCCTCCCTGGCTCCATTATGGTCACTGCCACCAATTTCTGTCCTCCAAACAATGCTTTACCAAACAATGCAGGAGGGTGGTGCAACCCTCCAATGCACCATTTTGACCTCTCTCAACCTGTTTTCCTTCGCATTGCACAATACAGAGCAGGAATTGTGCCTGTTTCCTACAGAAGGGTACCCTGCAGGAGAAGGGGAGGCATAAGGTTCACAATCAATGGCCACTCCTACTTCAACTTGGTCCTCATAACAAACGTAGGAGGTGCTGGGGATGTTCATGGTGTGGCCATCAAGGGGTCAAGAACAGGGTGGATGCCAATGTCCAGAAACTGGGGTCAAAATTGGCAAAGCAACAACTATCTCAATGGCCAAAGCCTCTCATTCAAGGTCACAACCAGTGATGGCCGTACAGCTGTGTCCTACAATGTTGCCCCTGCTGGTTGGTCCTTTGGCCAAACCTACACTGGTGCTCAATTCCGCTAG

>Glyma02g12140.1   sequence type=predicted peptide   gene model=Glyma02g12140   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAQICLLLVGLLSMFSSAYGYGYGGGWVNAHATFYGGSDASGTMGGACGYGNLYSQGYGTNTAALSTALFNNGLSCGSCYEIRCVNDHRWCLPGSIMVTATNFCPPNNALPNNAGGWCNPPMHHFDLSQPVFLRIAQYRAGIVPVSYRRVPCRRRGGIRFTINGHSYFNLVLITNVGGAGDVHGVAIKGSRTGWMPMSRNWGQNWQSNNYLNGQSLSFKVTTSDGRTAVSYNVAPAGWSFGQTYTGAQFR*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo