SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma02g10261

Feature Type:gene_model
Chromosome:Gm02
Start:8155483
stop:8156483
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma02g10261
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G12580AT Annotation by Michelle Graham. TAIR10: heat shock protein 70 | chr3:3991487-3993689 REVERSE LENGTH=650 SoyBaseE_val: 2.00E-76ISS
GO:0006457GO-bp Annotation by Michelle Graham. GO Biological Process: protein folding SoyBaseN/AISS
GO:0009266GO-bp Annotation by Michelle Graham. GO Biological Process: response to temperature stimulus SoyBaseN/AISS
GO:0009408GO-bp Annotation by Michelle Graham. GO Biological Process: response to heat SoyBaseN/AISS
GO:0009615GO-bp Annotation by Michelle Graham. GO Biological Process: response to virus SoyBaseN/AISS
GO:0009617GO-bp Annotation by Michelle Graham. GO Biological Process: response to bacterium SoyBaseN/AISS
GO:0009644GO-bp Annotation by Michelle Graham. GO Biological Process: response to high light intensity SoyBaseN/AISS
GO:0016567GO-bp Annotation by Michelle Graham. GO Biological Process: protein ubiquitination SoyBaseN/AISS
GO:0034976GO-bp Annotation by Michelle Graham. GO Biological Process: response to endoplasmic reticulum stress SoyBaseN/AISS
GO:0042542GO-bp Annotation by Michelle Graham. GO Biological Process: response to hydrogen peroxide SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0005618GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cell wall SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005774GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane SoyBaseN/AISS
GO:0005794GO-cc Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0048046GO-cc Annotation by Michelle Graham. GO Cellular Compartment: apoplast SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
GO:0031625GO-mf Annotation by Michelle Graham. GO Molecular Function: ubiquitin protein ligase binding SoyBaseN/AISS
PTHR19375Panther HEAT SHOCK PROTEIN 70KDA JGI ISS
PF00012PFAM Hsp70 protein JGI ISS
UniRef100_B7Q7S0UniRef Annotation by Michelle Graham. Most informative UniRef hit: Heat shock protein, putative (Fragment) n=1 Tax=Ixodes scapularis RepID=B7Q7S0_IXOSC SoyBaseE_val: 5.00E-119ISS
UniRef100_B7Q7S0UniRef Annotation by Michelle Graham. Best UniRef hit: Heat shock protein, putative (Fragment) n=1 Tax=Ixodes scapularis RepID=B7Q7S0_IXOSC SoyBaseE_val: 5.00E-119ISS

Expression Patterns of Glyma02g10261
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma02g10261 not represented in the dataset
Glyma02g10261 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma02g10261 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.02g092800 Wm82.a2.v1IGC As supplied by JGI

References for Glyma02g10261
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma02g10261
>Glyma02g10261.1   sequence type=CDS   gene model=Glyma02g10261   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGATTGGGGGTTGTTATTTTGCAGATGCCAAGAGGTTGATTGGTAGGAGAGTTAGCGACCCTTCTGTTCATAGTGATATGAAGTTGTGGCCATTTAAGGTTATTGCTGGTGCTGGTGAGAAACCCATGATTGGTGTCAATTACAAGGGTAAGGAAAAGCAATTTTCTACTGAGGAAATCTCCTCTATGGTCCTAACAAAGATGCGGAAGATTGCAGAGGCTTACCTTGGGTCGACTGTGAAGAATGCCTTTGTTACTGTGCCTGCTTACTTCAATGATTCTCAGCGTCAAGCCAGCAAAGATGTTGGTGTCATTACTGGCCTCAATGTTATGAGAATAATAAATGAGCCAACTGTTGTTGCAATTGCATTAGGACTAGACAAGAAAGCCACTAGTGTTGGTGAGAAGAATGTCTTGATCTTTGATCTTGGAGGTGGCACCTTTGATACCACTATTGAGATTGATTCTCTGTTTGAGGGCATTGACTTCTATTCAACCATCACTCGTGCTAGGTTTGAGGAGCTCAACATGAACCTTTTTAGGAAATGTATGGAGCCTGTGGAGAAGTGTCTTAGGGAAGCAAAGATGAGCAAGATCACCGTTCATGATGTTGTCCTCGTTGGTGGCTCTACAAGGATTCCTAAAGTTCAGCAGTTGTTGCAGGACTTCTTCAATGGGAAAGATCTATGCAAGAACATTAACCCCAATGAAGTCGCTGCTTATGGAGTTGCTGTCCAGGCAACTATATTGAGTGGTGAAGGAAATGAGAAGGTTCAAGATTTGTTGCTTTTGGATTTTACCCCATTGTCTTTGGGTTTGGAAACTGCTGGAGATGTCATGACT
Predicted protein sequences of Glyma02g10261
>Glyma02g10261.1   sequence type=predicted peptide   gene model=Glyma02g10261   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MIGGCYFADAKRLIGRRVSDPSVHSDMKLWPFKVIAGAGEKPMIGVNYKGKEKQFSTEEISSMVLTKMRKIAEAYLGSTVKNAFVTVPAYFNDSQRQASKDVGVITGLNVMRIINEPTVVAIALGLDKKATSVGEKNVLIFDLGGGTFDTTIEIDSLFEGIDFYSTITRARFEELNMNLFRKCMEPVEKCLREAKMSKITVHDVVLVGGSTRIPKVQQLLQDFFNGKDLCKNINPNEVAAYGVAVQATILSGEGNEKVQDLLLLDFTPLSLGLETAGDVMT






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo