|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT2G39530 | AT | Annotation by Michelle Graham. TAIR10: Uncharacterised protein family (UPF0497) | chr2:16498659-16499401 REVERSE LENGTH=178 | SoyBase | E_val: 2.00E-22 | ISS |
| GO:0006865 | GO-bp | Annotation by Michelle Graham. GO Biological Process: amino acid transport | SoyBase | N/A | ISS |
| GO:0006888 | GO-bp | Annotation by Michelle Graham. GO Biological Process: ER to Golgi vesicle-mediated transport | SoyBase | N/A | ISS |
| GO:0008150 | GO-bp | Annotation by Michelle Graham. GO Biological Process: biological process | SoyBase | N/A | ISS |
| GO:0043090 | GO-bp | Annotation by Michelle Graham. GO Biological Process: amino acid import | SoyBase | N/A | ISS |
| GO:0009507 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: chloroplast | SoyBase | N/A | ISS |
| GO:0016020 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: membrane | SoyBase | N/A | ISS |
| GO:0003674 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: molecular function | SoyBase | N/A | ISS |
| PF04535 | PFAM | Domain of unknown function (DUF588) | JGI | ISS | |
| UniRef100_C6T1Z6 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: CASP-like protein 12 n=1 Tax=Glycine max RepID=CSPLC_SOYBN | SoyBase | E_val: 2.00E-51 | ISS |
| UniRef100_I1JDP4 | UniRef | Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JDP4_SOYBN | SoyBase | E_val: 2.00E-115 | ISS |
|
Glyma02g10240 not represented in the dataset |
Glyma02g10240 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.02g092600 | Wm82.a2.v1 | IGC | As supplied by JGI |
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma02g10240.1 sequence type=CDS gene model=Glyma02g10240 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGGAAAACACTACTACCACACACTCAAAAATTTCTACCTTTTCATTTACTGTCCTCCTTTTGAGGGTCTTAACCTTTATCTTCCTTGTTATGGCGCTCATTTTCATTTCCATAGACACGCTACCAATAGAAACAAGTGATTACGCAGTTTATGAAGAAATCAACTTCAATTATGTCTATGCTTATCGATATATGCTCTCTACGATAGTTATTGGGTTTGCGTATAACCTCCTGCAAATGGGCTTTTCAATCTTCACTGTGGTCTCAGGGAAGCGTGTATTAAGCAGTTATGGTGGCTATCTATTTGATTTCTTTGGTGACCAGATCATATCATACCTTCTGATTTCTGGTTCAGCTGCTGAATTTGGTTACGACGTACAACGGCGTAGAGTTACAAACTCCTTCACTGAAAAGGCAAATGTTTCGGCCAGCCTTCTTCTAGTTGGGTTTTTGTTCACTGCCACAGCATCAATTTTCACTTCCTTTGCTTTGCCAAAGAAAGCTATCAATTAA
>Glyma02g10240.1 sequence type=predicted peptide gene model=Glyma02g10240 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MENTTTTHSKISTFSFTVLLLRVLTFIFLVMALIFISIDTLPIETSDYAVYEEINFNYVYAYRYMLSTIVIGFAYNLLQMGFSIFTVVSGKRVLSSYGGYLFDFFGDQIISYLLISGSAAEFGYDVQRRRVTNSFTEKANVSASLLLVGFLFTATASIFTSFALPKKAIN*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||