SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma02g10240

Feature Type:gene_model
Chromosome:Gm02
Start:8098304
stop:8100669
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G39530AT Annotation by Michelle Graham. TAIR10: Uncharacterised protein family (UPF0497) | chr2:16498659-16499401 REVERSE LENGTH=178 SoyBaseE_val: 2.00E-22ISS
GO:0006865GO-bp Annotation by Michelle Graham. GO Biological Process: amino acid transport SoyBaseN/AISS
GO:0006888GO-bp Annotation by Michelle Graham. GO Biological Process: ER to Golgi vesicle-mediated transport SoyBaseN/AISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0043090GO-bp Annotation by Michelle Graham. GO Biological Process: amino acid import SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
PF04535PFAM Domain of unknown function (DUF588) JGI ISS
UniRef100_C6T1Z6UniRef Annotation by Michelle Graham. Most informative UniRef hit: CASP-like protein 12 n=1 Tax=Glycine max RepID=CSPLC_SOYBN SoyBaseE_val: 2.00E-51ISS
UniRef100_I1JDP4UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JDP4_SOYBN SoyBaseE_val: 2.00E-115ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.02g092600 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma02g10240.1   sequence type=CDS   gene model=Glyma02g10240   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAAAACACTACTACCACACACTCAAAAATTTCTACCTTTTCATTTACTGTCCTCCTTTTGAGGGTCTTAACCTTTATCTTCCTTGTTATGGCGCTCATTTTCATTTCCATAGACACGCTACCAATAGAAACAAGTGATTACGCAGTTTATGAAGAAATCAACTTCAATTATGTCTATGCTTATCGATATATGCTCTCTACGATAGTTATTGGGTTTGCGTATAACCTCCTGCAAATGGGCTTTTCAATCTTCACTGTGGTCTCAGGGAAGCGTGTATTAAGCAGTTATGGTGGCTATCTATTTGATTTCTTTGGTGACCAGATCATATCATACCTTCTGATTTCTGGTTCAGCTGCTGAATTTGGTTACGACGTACAACGGCGTAGAGTTACAAACTCCTTCACTGAAAAGGCAAATGTTTCGGCCAGCCTTCTTCTAGTTGGGTTTTTGTTCACTGCCACAGCATCAATTTTCACTTCCTTTGCTTTGCCAAAGAAAGCTATCAATTAA

>Glyma02g10240.1   sequence type=predicted peptide   gene model=Glyma02g10240   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MENTTTTHSKISTFSFTVLLLRVLTFIFLVMALIFISIDTLPIETSDYAVYEEINFNYVYAYRYMLSTIVIGFAYNLLQMGFSIFTVVSGKRVLSSYGGYLFDFFGDQIISYLLISGSAAEFGYDVQRRRVTNSFTEKANVSASLLLVGFLFTATASIFTSFALPKKAIN*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo