SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Notice: fwrite(): Write of 157 bytes failed with errno=28 No space left on device in /var/www/html/include/SeqFeatClass.php on line 369

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma02g04571): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma02g04571): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma02g04571

Feature Type:gene_model
Chromosome:Gm02
Start:3737632
stop:3741053
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G22480AT Annotation by Michelle Graham. TAIR10: phosphofructokinase 5 | chr2:9545670-9548414 FORWARD LENGTH=537 SoyBaseE_val: 2.00E-84ISS
GO:0006094GO-bp Annotation by Michelle Graham. GO Biological Process: gluconeogenesis SoyBaseN/AISS
GO:0006096GO-bp Annotation by Michelle Graham. GO Biological Process: glycolysis SoyBaseN/AISS
GO:0007010GO-bp Annotation by Michelle Graham. GO Biological Process: cytoskeleton organization SoyBaseN/AISS
GO:0010498GO-bp Annotation by Michelle Graham. GO Biological Process: proteasomal protein catabolic process SoyBaseN/AISS
GO:0005945GO-cc Annotation by Michelle Graham. GO Cellular Compartment: 6-phosphofructokinase complex SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0003872GO-mf Annotation by Michelle Graham. GO Molecular Function: 6-phosphofructokinase activity SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
PTHR13697Panther PHOSPHOFRUCTOKINASE JGI ISS
PF00365PFAM Phosphofructokinase JGI ISS
UniRef100_G7JXR3UniRef Annotation by Michelle Graham. Most informative UniRef hit: 6-phosphofructokinase n=1 Tax=Medicago truncatula RepID=G7JXR3_MEDTR SoyBaseE_val: 2.00E-92ISS
UniRef100_UPI0002336E53UniRef Annotation by Michelle Graham. Best UniRef hit: UPI0002336E53 related cluster n=1 Tax=unknown RepID=UPI0002336E53 SoyBaseE_val: 6.00E-173ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma02g04571 not represented in the dataset

Glyma02g04571 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma01g03040 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma02g04571.1   sequence type=CDS   gene model=Glyma02g04571   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCGCCGGTGATCACTCTTCATTGCTTAACAACTTCTTCTACCCGTTGCTCCTACGGTTTCAATAACTCCAATTCTCGTTTCAATGCATTGGTGGAACCTACCAGAGGCTCTAGCGTCTTTGCCAAGGTTAAGAGCCAAAGCTCTGCTTCCAAGTTCAACAACAATCCTGATTGGAAAACCAAGTTCAAGGACGACTCTGAAGACCGTTTCAGACTCCCCCATGTCACTGATATCTTCCCTGATGCTGTTTCCATGCCCTCTACGTTCTCTCCCAATATGAGAACTCCTAGGACTAGTGACTTTCCTGGTTATCCTTTGGACGAGGATTGGTATGGATATATTAATGACAATGACAGAGTGCTTCTTAAGACAATATACTATTCATCCTCTACATCTGCTGGCGCCAAGTGCATTGATCCTGGTTGTAATTGGGTGGAACAAAGGTCATTAAATTGTTTCTCAATGTTTGATTCAATATTGGATGTGCTGCAGATTGTAGTCACACTCGAAATATACGATGTAACAATTGTGGGTATTCCTTTTGGTTATCGTGGATTTTCAGACGAAGAGCTGACAGAGCTGTCAAGGAAAGTGGTTCAGAATATTCATCTTTCAGGTGGAAGAAGCCTATTGGGAGTTTCACGTGGAGGACCTGGAGTCAGTGAAATTGTGGACAATTTGAAGGAAAGAGGGATCAACATGCTCTTTGTGTTGGGTGGAAATGACACACATGCTGGTGCAAATGCAATTCATAATGAGGTTATCAATCCTTTATCTCTGTATTAA

>Glyma02g04571.1   sequence type=predicted peptide   gene model=Glyma02g04571   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSPVITLHCLTTSSTRCSYGFNNSNSRFNALVEPTRGSSVFAKVKSQSSASKFNNNPDWKTKFKDDSEDRFRLPHVTDIFPDAVSMPSTFSPNMRTPRTSDFPGYPLDEDWYGYINDNDRVLLKTIYYSSSTSAGAKCIDPGCNWVEQRSLNCFSMFDSILDVLQIVVTLEIYDVTIVGIPFGYRGFSDEELTELSRKVVQNIHLSGGRSLLGVSRGGPGVSEIVDNLKERGINMLFVLGGNDTHAGANAIHNEVINPLSLY*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo