Warning : Undefined variable $sxsome in
/var/www/html/include/SeqFeatClass.php on line
665
Warning : Undefined variable $sstart in
/var/www/html/include/SeqFeatClass.php on line
665
Warning : Undefined variable $send in
/var/www/html/include/SeqFeatClass.php on line
665
Warning : get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in
/var/www/html/include/SeqFeatClass.php on line
1018
Warning : get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma02g04270): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in
/var/www/html/include/SeqFeatClass.php on line
1018
Warning : Trying to access array offset on false in
/var/www/html/include/SeqFeatClass.php on line
1019
Warning : get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in
/var/www/html/include/SeqFeatClass.php on line
1020
Warning : get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma02g04270): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in
/var/www/html/include/SeqFeatClass.php on line
1020
Warning : Trying to access array offset on false in
/var/www/html/include/SeqFeatClass.php on line
1021
Deprecated : preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in
/var/www/html/include/SeqFeatClass.php on line
1025
Deprecated : preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in
/var/www/html/include/SeqFeatClass.php on line
1031
Report for Sequence Feature Glyma02g04270
Feature Type: gene_model
Chromosome: Gm02
Start: 3460636
stop: 3466265
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma02g04270
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT1G70560 AT
Annotation by Michelle Graham. TAIR10: tryptophan aminotransferase of Arabidopsis 1 | chr1:26604894-26607319 FORWARD LENGTH=391
SoyBase E_val: 4.00E-150 ISS
GO:0009641 GO-bp
Annotation by Michelle Graham. GO Biological Process: shade avoidance
SoyBase N/A ISS
GO:0009684 GO-bp
Annotation by Michelle Graham. GO Biological Process: indoleacetic acid biosynthetic process
SoyBase N/A ISS
GO:0009723 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus
SoyBase N/A ISS
GO:0009793 GO-bp
Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy
SoyBase N/A ISS
GO:0009908 GO-bp
Annotation by Michelle Graham. GO Biological Process: flower development
SoyBase N/A ISS
GO:0009958 GO-bp
Annotation by Michelle Graham. GO Biological Process: positive gravitropism
SoyBase N/A ISS
GO:0010078 GO-bp
Annotation by Michelle Graham. GO Biological Process: maintenance of root meristem identity
SoyBase N/A ISS
GO:0010087 GO-bp
Annotation by Michelle Graham. GO Biological Process: phloem or xylem histogenesis
SoyBase N/A ISS
GO:0010588 GO-bp
Annotation by Michelle Graham. GO Biological Process: cotyledon vascular tissue pattern formation
SoyBase N/A ISS
GO:0016126 GO-bp
Annotation by Michelle Graham. GO Biological Process: sterol biosynthetic process
SoyBase N/A ISS
GO:0042742 GO-bp
Annotation by Michelle Graham. GO Biological Process: defense response to bacterium
SoyBase N/A ISS
GO:0048364 GO-bp
Annotation by Michelle Graham. GO Biological Process: root development
SoyBase N/A ISS
GO:0048366 GO-bp
Annotation by Michelle Graham. GO Biological Process: leaf development
SoyBase N/A ISS
GO:0048467 GO-bp
Annotation by Michelle Graham. GO Biological Process: gynoecium development
SoyBase N/A ISS
GO:0048825 GO-bp
Annotation by Michelle Graham. GO Biological Process: cotyledon development
SoyBase N/A ISS
GO:0080022 GO-bp
Annotation by Michelle Graham. GO Biological Process: primary root development
SoyBase N/A ISS
GO:0005634 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: nucleus
SoyBase N/A ISS
GO:0005737 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm
SoyBase N/A ISS
GO:0003824 GO-mf
Annotation by Michelle Graham. GO Molecular Function: catalytic activity
SoyBase N/A ISS
GO:0004021 GO-mf
Annotation by Michelle Graham. GO Molecular Function: L-alanine:2-oxoglutarate aminotransferase activity
SoyBase N/A ISS
GO:0004838 GO-mf
Annotation by Michelle Graham. GO Molecular Function: L-tyrosine:2-oxoglutarate aminotransferase activity
SoyBase N/A ISS
GO:0016846 GO-mf
Annotation by Michelle Graham. GO Molecular Function: carbon-sulfur lyase activity
SoyBase N/A ISS
GO:0030170 GO-mf
Annotation by Michelle Graham. GO Molecular Function: pyridoxal phosphate binding
SoyBase N/A ISS
GO:0047312 GO-mf
Annotation by Michelle Graham. GO Molecular Function: L-phenylalanine:pyruvate aminotransferase activity
SoyBase N/A ISS
GO:0050048 GO-mf
Annotation by Michelle Graham. GO Molecular Function: L-leucine:2-oxoglutarate aminotransferase activity
SoyBase N/A ISS
GO:0050362 GO-mf
Annotation by Michelle Graham. GO Molecular Function: L-tryptophan:2-oxoglutarate aminotransferase activity
SoyBase N/A ISS
GO:0080097 GO-mf
Annotation by Michelle Graham. GO Molecular Function: L-tryptophan:pyruvate aminotransferase activity
SoyBase N/A ISS
GO:0080098 GO-mf
Annotation by Michelle Graham. GO Molecular Function: L-tyrosine:pyruvate aminotransferase activity
SoyBase N/A ISS
GO:0080099 GO-mf
Annotation by Michelle Graham. GO Molecular Function: L-methionine:2-oxoglutarate aminotransferase activity
SoyBase N/A ISS
GO:0080100 GO-mf
Annotation by Michelle Graham. GO Molecular Function: L-glutamine:2-oxoglutarate aminotransferase activity
SoyBase N/A ISS
GO:0080130 GO-mf
Annotation by Michelle Graham. GO Molecular Function: L-phenylalanine:2-oxoglutarate aminotransferase activity
SoyBase N/A ISS
PTHR11751 Panther
SUBGROUP I AMINOTRANSFERASE RELATED
JGI ISS
PTHR11751:SF162 Panther
SUBFAMILY NOT NAMED
JGI ISS
PF04864 PFAM
Allinase
JGI ISS
UniRef100_G7K044 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Alliin lyase n=1 Tax=Medicago truncatula RepID=G7K044_MEDTR
SoyBase E_val: 0 ISS
UniRef100_I1J558 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=2 Tax=Glycine max RepID=I1J558_SOYBN
SoyBase E_val: 0 ISS
Expression Patterns of Glyma02g04270
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma02g04270
Paralog Evidence Comments
Glyma01g03340 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma02g04270 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.02g037600 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma02g04270
Coding sequences of Glyma02g04270
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma02g04270.1 sequence type=CDS gene model=Glyma02g04270 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGGTGGTAGCTACAAATGGCTTCCCTTCTTCCAATGCCACAATCCCCCCAACAAATATCTCTCCTAATGCCATCCTACCTCTTGATCGGGGCGATCCGGTAGTGTTCGAAGAATACTGGAAAAAGATGTGTGAGTCCTGCACCGTAGTTATCAAAGGGTGGGAGCTAATGAGCTATCTGAGTGACATGAGCAACGTGTGCTGGTACATGTTGCCGGAGATGAAGGAAGCCATTAAAAGGCTTCATCACGTGGTGGGAAATGCTGTTACTGAAGACAGATACATTGTGGTAGGGAATGGAGCAACGCAACTATTACAGGGAGCTGTTTTTGCTCTCTCTCCTTCGGAGGCTAATTCTCAACCCATCAACGTTGTTGCTGCTGTTCCATACTATTCGGAATACCAAGATGAGGTTGATATTTTGCGTTCAGGATTGTATCAATGGGCTGGTGATGCTGCTTCGTATGAGAAAAATGAACCCTACATAGAGGTGGTAACCTCTCCAAACAACCCTGATGGGACTATGAGGGGTCCTGTGGTGAAATCTGAAGCTGAAGGGAAGCTGATTCATGATCTTGCCTATTACTGGCCACACTACACTCCCATTACTCACCAAGCTGACCATGATATCATGATCTTCACATTCTCCAAATGCACTGGTCATGCTGGTTCACGTTTAGGGTGGGCCATTGTGAAGGACATTGAGGTTGCTAAGAAGATGACAAGGTATGTGCAGATGAGCTCCATTGGAGTCTCAAAAGAATCCCAAACTCGAGTTGCTAAGATCATGGGAGTGATTTGCGATGGCTACCAAAACTTTGGGTCCATGAAGTCTGAGCTCTTCTTTGAATATAGCAAACGCATCTTGAAGCAGAGGTGGGAGAAATTGTGGGAAGTTATTGAGGAAAGCAAGGTCTTCTCTGTGGCCAAGTACCCTAAGGCCTATTGCAACTTCACTAACGAGTCATCTGAATCTTTCCCTGGTTTTATATGGTTGAAGTGTAAGGAGGGCATAGAAGATTGTGGGAGTTATCTGCTGGAAAAATTGAAGATTCGTGCAAGAGAAGGAGAACGATTTGGTGTTAGTCCAAAGTATGCTAGAATTAGCATGATAGGAACGGATGATGAGTTCAATGAATTTCTGAAAAGGGTGTCAAATGCTAAAAAAGAATGTGACTAG
Predicted protein sequences of Glyma02g04270
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma02g04270.1 sequence type=predicted peptide gene model=Glyma02g04270 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MVVATNGFPSSNATIPPTNISPNAILPLDRGDPVVFEEYWKKMCESCTVVIKGWELMSYLSDMSNVCWYMLPEMKEAIKRLHHVVGNAVTEDRYIVVGNGATQLLQGAVFALSPSEANSQPINVVAAVPYYSEYQDEVDILRSGLYQWAGDAASYEKNEPYIEVVTSPNNPDGTMRGPVVKSEAEGKLIHDLAYYWPHYTPITHQADHDIMIFTFSKCTGHAGSRLGWAIVKDIEVAKKMTRYVQMSSIGVSKESQTRVAKIMGVICDGYQNFGSMKSELFFEYSKRILKQRWEKLWEVIEESKVFSVAKYPKAYCNFTNESSESFPGFIWLKCKEGIEDCGSYLLEKLKIRAREGERFGVSPKYARISMIGTDDEFNEFLKRVSNAKKECD*