Glyma02g03280 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma02g03280

Feature Type:	gene_model
Chromosome:	Gm02
Start:	2540712
stop:	2542352
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma02g03280

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
UniRef100_B6CAM2	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Matrix metalloproteinase n=1 Tax=Glycine max RepID=B6CAM2_SOYBN	SoyBase	E_val: 3.00E-09	ISS
UniRef100_C6TFW0	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6TFW0_SOYBN	SoyBase	E_val: 4.00E-77	ISS

Expression Patterns of Glyma02g03280

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma02g03280 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.02g028400	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma02g03280

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma02g03280

Limit To All Plant Sequences

>Glyma02g03280.1   sequence type=CDS   gene model=Glyma02g03280   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAACCGTACCTACGTCCAATATTCCTATTATTCCTTATCCTTCTCGACCAATCCATTTCGGCGAGTGCTGCTATAAATATTAATGGTCTGAGAAACAAAATTAGAGAAGTTCTAAACAAGCACCCGAGCATCAATCTTCCGGCAGATAAACTGAAGAAGGTGAAGAGACCACTGAAGGCACTGGATTATCTGCTTGGCGAATGTAAGGACAGGCCGCCTCAAGAATTTCAAGAATTTTGCCCGAAATTTAAGAACGATTATCAACAAAATTGCCCGAATGCCGCGTATGAAGCAGTTTGCCCGTTACTGAAGCAAGCGATTCAAATATGTTGCCAGAAACACGCATAA

Predicted protein sequences of Glyma02g03280

Limit To All Plant Sequences

>Glyma02g03280.1   sequence type=predicted peptide   gene model=Glyma02g03280   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKPYLRPIFLLFLILLDQSISASAAININGLRNKIREVLNKHPSINLPADKLKKVKRPLKALDYLLGECKDRPPQEFQEFCPKFKNDYQQNCPNAAYEAVCPLLKQAIQICCQKHA*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain