SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma02g02934

Feature Type:gene_model
Chromosome:Gm02
Start:2245799
stop:2249704
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma02g02934
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G59640AT Annotation by Michelle Graham. TAIR10: BIG PETAL P | chr1:21909464-21911030 REVERSE LENGTH=264 SoyBaseE_val: 9.00E-89ISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0009062GO-bp Annotation by Michelle Graham. GO Biological Process: fatty acid catabolic process SoyBaseN/AISS
GO:0009694GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid metabolic process SoyBaseN/AISS
GO:0009753GO-bp Annotation by Michelle Graham. GO Biological Process: response to jasmonic acid stimulus SoyBaseN/AISS
GO:0009827GO-bp Annotation by Michelle Graham. GO Biological Process: plant-type cell wall modification SoyBaseN/AISS
GO:0009860GO-bp Annotation by Michelle Graham. GO Biological Process: pollen tube growth SoyBaseN/AISS
GO:0010162GO-bp Annotation by Michelle Graham. GO Biological Process: seed dormancy process SoyBaseN/AISS
GO:0048441GO-bp Annotation by Michelle Graham. GO Biological Process: petal development SoyBaseN/AISS
GO:0048443GO-bp Annotation by Michelle Graham. GO Biological Process: stamen development SoyBaseN/AISS
GO:0048446GO-bp Annotation by Michelle Graham. GO Biological Process: petal morphogenesis SoyBaseN/AISS
GO:0048481GO-bp Annotation by Michelle Graham. GO Biological Process: ovule development SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
PTHR12565Panther STEROL REGULATORY ELEMENT-BINDING PROTEIN JGI ISS
PTHR12565:SF7Panther CENTROMERE-BINDING PROTEIN 1, CBP-1 JGI ISS
PF00010PFAM Helix-loop-helix DNA-binding domain JGI ISS
UniRef100_G7K714UniRef Annotation by Michelle Graham. Most informative UniRef hit: BHLH transcription factor n=1 Tax=Medicago truncatula RepID=G7K714_MEDTR SoyBaseE_val: 1.00E-95ISS
UniRef100_UPI000233775AUniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233775A related cluster n=1 Tax=unknown RepID=UPI000233775A SoyBaseE_val: 0ISS

Expression Patterns of Glyma02g02934
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma02g02934 not represented in the dataset
Glyma02g02934 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma02g02934 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.02g025400 Wm82.a2.v1IGC As supplied by JGI

References for Glyma02g02934
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma02g02934
>Glyma02g02934.1   sequence type=CDS   gene model=Glyma02g02934   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGATCCGGCGGCCATGATGAACGCCGCCGCCAACACGGCGTCATATCACCTGTCAGAGATCTGGCACTTCCCGCCTCCCAACGCGCCAGACGCGCTGGGCCTCAGGAGGGCCCACTTCGCCCCGGGTCCGACCCGACATGCCGTCCCGGGTCGCGACCTGGCTAGCATCGCCCCCAAGAAGCGCCGCCAAGCCGAGGAGGAGGAGGTGGAATCCACTAGGGGCGCTTCCACCACCAATGCCGTGGATGAGGGTTGTGGTGATGGAAAACGGGTTAAGACGAGTGAGAGTGGGAAAGGTGAAGGAGAAAGCTGTTCAGGAAAGCCTGCGAAGCAAAGCGGTAAGCCACCTTCGGAGCCTCCAAAGCAAGACTACATTCATGTCAGAGCTAGAAGAGGTCAAGCTACTGATAGCCACAGTCTTGCAGAAAGAGCTAGACGGGAGAAGATCAGTGAAAGGATGAAAATTCTTCAGGATTTAGTCCCGGGTTGTAATAAGGTTATTGGGAAAGCATTGGTCCTTGATGAGATAATTAATTATATCCAATCACTTCAGCGGCAAGTAGAGTTTTTGTCAATGAAGCTTGAAGCAGTAAATTCAAGAATTGCCCCCGGAATCGAAGTGTTTCCTCCGAAAGATTTTGATCAGCAAACATTCGATACAACTGGCATGCCATTCGCTTCTCAAGCTACAAGAGACTATAGCCGAGGCTCATCACCGGAGTGGTTACATATGCAGGTTGGAGATGGTTTTGAAAGAGCAACGTAG
Predicted protein sequences of Glyma02g02934
>Glyma02g02934.1   sequence type=predicted peptide   gene model=Glyma02g02934   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MDPAAMMNAAANTASYHLSEIWHFPPPNAPDALGLRRAHFAPGPTRHAVPGRDLASIAPKKRRQAEEEEVESTRGASTTNAVDEGCGDGKRVKTSESGKGEGESCSGKPAKQSGKPPSEPPKQDYIHVRARRGQATDSHSLAERARREKISERMKILQDLVPGCNKVIGKALVLDEIINYIQSLQRQVEFLSMKLEAVNSRIAPGIEVFPPKDFDQQTFDTTGMPFASQATRDYSRGSSPEWLHMQVGDGFERAT*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo