Glyma02g02752 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma02g02752

Feature Type:	gene_model
Chromosome:	Gm02
Start:	2095915
stop:	2096300
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma02g02752

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G41540	AT	Annotation by Michelle Graham. TAIR10: Disease resistance protein (TIR-NBS-LRR class) family \| chr5:16612659-16616063 REVERSE LENGTH=1038	SoyBase	E_val: 6.00E-23	ISS
GO:0006952	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response	SoyBase	N/A	ISS
GO:0007165	GO-bp	Annotation by Michelle Graham. GO Biological Process: signal transduction	SoyBase	N/A	ISS
GO:0005622	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: intracellular	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0000166	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nucleotide binding	SoyBase	N/A	ISS
GO:0017111	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nucleoside-triphosphatase activity	SoyBase	N/A	ISS
GO:0043531	GO-mf	Annotation by Michelle Graham. GO Molecular Function: ADP binding	SoyBase	N/A	ISS
PTHR23155	Panther	LEUCINE-RICH REPEAT-CONTAINING PROTEIN	JGI		ISS
PTHR23155:SF252	Panther	SUBFAMILY NOT NAMED	JGI		ISS
PF01582	PFAM	TIR domain	JGI		ISS
UniRef100_G7K8C7	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: TMV resistance protein N n=1 Tax=Medicago truncatula RepID=G7K8C7_MEDTR	SoyBase	E_val: 7.00E-41	ISS
UniRef100_G7K8C7	UniRef	Annotation by Michelle Graham. Best UniRef hit: TMV resistance protein N n=1 Tax=Medicago truncatula RepID=G7K8C7_MEDTR	SoyBase	E_val: 7.00E-41	ISS

Expression Patterns of Glyma02g02752

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma02g02752 not represented in the dataset	Glyma02g02752 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma02g02752 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma02g02752

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma02g02752

Limit To All Plant Sequences

>Glyma02g02752.1   sequence type=CDS   gene model=Glyma02g02752   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAGTGTTCCTTAGCCTTAGCTTTAAAGGTGAGGACACACGCTACACTTTCACAAGCCATCTCTGTGCTGCCTTACTACAACCTAGAGAGAGGGGATGAAATATCAACCGTGCTTCTAAGGGCAATTCAGGAATCAAAGCTTTCGGTGGTTGTATTTTCCAAAAATTATGCCACTTCAAAGTGGTGTTTGAATGAGCTTGTCAAAATACTTGAATGTAAAAAGATGAATAGGCAAATTATAGTGCCTGTTTTCAATGATAGAGATCCATCCACTGTGCGTAATCAGAGTGGAACTTACGCGGTTGCGTTTGCTAAACATGAACAACAATTGAGAGGTGATATAAGAAGAGTGAAA

Predicted protein sequences of Glyma02g02752

Limit To All Plant Sequences

>Glyma02g02752.1   sequence type=predicted peptide   gene model=Glyma02g02752   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKCSLALALKVRTHATLSQAISVLPYYNLERGDEISTVLLRAIQESKLSVVVFSKNYATSKWCLNELVKILECKKMNRQIIVPVFNDRDPSTVRNQSGTYAVAFAKHEQQLRGDIRRVK

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain