SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma02g02215

Feature Type:gene_model
Chromosome:Gm02
Start:1580065
stop:1582585
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma02g02215
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G72090AT Annotation by Michelle Graham. TAIR10: Methylthiotransferase | chr1:27123617-27126767 FORWARD LENGTH=601 SoyBaseE_val: 2.00E-62ISS
GO:0009451GO-bp Annotation by Michelle Graham. GO Biological Process: RNA modification SoyBaseN/AISS
GO:0043412GO-bp Annotation by Michelle Graham. GO Biological Process: macromolecule modification SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005783GO-cc Annotation by Michelle Graham. GO Cellular Compartment: endoplasmic reticulum SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0003824GO-mf Annotation by Michelle Graham. GO Molecular Function: catalytic activity SoyBaseN/AISS
GO:0016740GO-mf Annotation by Michelle Graham. GO Molecular Function: transferase activity SoyBaseN/AISS
GO:0051536GO-mf Annotation by Michelle Graham. GO Molecular Function: iron-sulfur cluster binding SoyBaseN/AISS
GO:0051539GO-mf Annotation by Michelle Graham. GO Molecular Function: 4 iron, 4 sulfur cluster binding SoyBaseN/AISS
PTHR11918Panther RADICAL SAM PROTEINS JGI ISS
PTHR11918:SF41Panther UNCHARACTERIZED JGI ISS
UniRef100_B9S747UniRef Annotation by Michelle Graham. Most informative UniRef hit: Radical sam protein, putative n=1 Tax=Ricinus communis RepID=B9S747_RICCO SoyBaseE_val: 7.00E-62ISS
UniRef100_I1JBL9UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JBL9_SOYBN SoyBaseE_val: 3.00E-137ISS

Expression Patterns of Glyma02g02215
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma02g02215 not represented in the dataset
Glyma02g02215 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma02g02215 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.02g018600 Wm82.a2.v1IGC As supplied by JGI

References for Glyma02g02215
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma02g02215
>Glyma02g02215.1   sequence type=CDS   gene model=Glyma02g02215   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAGAACAGATACTTGGCACATGCTCAACACCATCCTCCATTTCATGACTCTGCACTTCCAAAGAGAAAGTTGGATAAGAGTTGCACAGTTAAATCCCCAAGCCAATATGCCATGGATGCCATCATATCAAAAGGAAAATCTTCAAATAAACCACTAGTTGTTGTTGGTTGTTTCCCTCAAGGAAGTCGAGATTTGAAAGACCTCGAACGGATCAGCATAATTGGAGTCCAGCAAATCAATCGTGTTTTTGAAATTGTAGAGAAGACTTTAAAAGGTCATGAAGTGCGCCTTTTGACCTGTCAGAAATTGGCAACACTTGAGCTTCAAAAGGTAAGGAAGAACGAGTTTGTTGAGATTCTTCCTATTAATGTTGGTTGTTTAGGTGCTTGCACTTATTGCAAGACAAAGCATGTTCGGGGTCACCTAAGAAGTTACACAATTGATAGCCTTATTGGGTGTGTAAAATCTATGATATCCGAAGGGGTTAGAGCTTTGTTGTGGAAAGTTGTCTACTCTGAGCACTCAGATCCTAAGTCACTGTGGGTTGCTACCTTGGATCCAAATGGTGCAATCACTTTTTATGATCTCAACAAAAGGAGGGCTCCAAACCCTGAGGCGGTTAAGGTACCACAAGACCCTTGTGGCATTCCTCAGTCTAGTGATCTTTATTGTGGTTGCTTCTTTGAAAACTGGTGCATCTATCCCAAACTTATCAAATCTCACTTTAATTGCAAACCTCCCAACATCTCCACCTGTTCTAGGAGTTCAACGAAATTTATATATGTTGATGAAGAGCTTGATTATTTTGCTTTTTAA
Predicted protein sequences of Glyma02g02215
>Glyma02g02215.1   sequence type=predicted peptide   gene model=Glyma02g02215   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKNRYLAHAQHHPPFHDSALPKRKLDKSCTVKSPSQYAMDAIISKGKSSNKPLVVVGCFPQGSRDLKDLERISIIGVQQINRVFEIVEKTLKGHEVRLLTCQKLATLELQKVRKNEFVEILPINVGCLGACTYCKTKHVRGHLRSYTIDSLIGCVKSMISEGVRALLWKVVYSEHSDPKSLWVATLDPNGAITFYDLNKRRAPNPEAVKVPQDPCGIPQSSDLYCGCFFENWCIYPKLIKSHFNCKPPNISTCSRSSTKFIYVDEELDYFAF*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo