Report for Sequence Feature Glyma02g02050
Feature Type: gene_model
Chromosome: Gm02
Start: 1487519
stop: 1488472
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma02g02050
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT4G02360 AT
Annotation by Michelle Graham. TAIR10: Protein of unknown function, DUF538 | chr4:1041179-1041643 FORWARD LENGTH=154
SoyBase E_val: 1.00E-49 ISS
GO:0008150 GO-bp
Annotation by Michelle Graham. GO Biological Process: biological process
SoyBase N/A ISS
GO:0005576 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: extracellular region
SoyBase N/A ISS
GO:0003674 GO-mf
Annotation by Michelle Graham. GO Molecular Function: molecular function
SoyBase N/A ISS
PF04398 PFAM
Protein of unknown function, DUF538
JGI ISS
UniRef100_I1JBK4 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JBK4_SOYBN
SoyBase E_val: 1.00E-111 ISS
UniRef100_O81296 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: AT4g02370 protein n=1 Tax=Arabidopsis thaliana RepID=O81296_ARATH
SoyBase E_val: 3.00E-45 ISS
Expression Patterns of Glyma02g02050
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma02g02050
Paralog Evidence Comments
Glyma10g02180 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma02g02050 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.02g016900 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma02g02050
Coding sequences of Glyma02g02050
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma02g02050.1 sequence type=CDS gene model=Glyma02g02050 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGATGTCTTCAATTAGATTCCTATGGATCCTGGTGGTGTGTTTGACGGCATCATGCGCGCTAAGCCAACCGCAGAAGCTATCAGCGTACGATGTTCTCATGGAGTACGGCTTCCCGGTGGGTCTTCTTCCGAAGGGAGCCATAGGGTATTCACTGAACAGAGACAGCGGCGAGTTCGCTGTGTATTTTGAAGGAGCCTGCAGCTTCGACATAGAATCCTACGCGCTCAAGTACAAGTCCACAATCACGGGTGTGATCTCCAAGGGCAGGCTCTACAATCTCAAAGGTGTCACCGTCAAAATCTTGCTCCTGTGGCTCAACATCGTCGAGGTCTCTCGTCAGGGCAACGATATTTACTTCTCTGTCGGCATCGCTTCCGCTGATTTCGGCGTCGAGAACTTCCTCGAGAGCCCCCAATGTGGTTGTGGCTTCGATTGCAAAACGCTCCCCTTAAACGGTGACGTTTACGTTTCCTCAATTTAA
Predicted protein sequences of Glyma02g02050
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma02g02050.1 sequence type=predicted peptide gene model=Glyma02g02050 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MMSSIRFLWILVVCLTASCALSQPQKLSAYDVLMEYGFPVGLLPKGAIGYSLNRDSGEFAVYFEGACSFDIESYALKYKSTITGVISKGRLYNLKGVTVKILLLWLNIVEVSRQGNDIYFSVGIASADFGVENFLESPQCGCGFDCKTLPLNGDVYVSSI*