SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma02g01950

Feature Type:gene_model
Chromosome:Gm02
Start:1424293
stop:1426375
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma02g01950
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G16780AT Annotation by Michelle Graham. TAIR10: Ribosomal protein L19e family protein | chr3:5708982-5710249 FORWARD LENGTH=209 SoyBaseE_val: 4.00E-127ISS
GO:0001510GO-bp Annotation by Michelle Graham. GO Biological Process: RNA methylation SoyBaseN/AISS
GO:0006342GO-bp Annotation by Michelle Graham. GO Biological Process: chromatin silencing SoyBaseN/AISS
GO:0006412GO-bp Annotation by Michelle Graham. GO Biological Process: translation SoyBaseN/AISS
GO:0009165GO-bp Annotation by Michelle Graham. GO Biological Process: nucleotide biosynthetic process SoyBaseN/AISS
GO:0009220GO-bp Annotation by Michelle Graham. GO Biological Process: pyrimidine ribonucleotide biosynthetic process SoyBaseN/AISS
GO:0042254GO-bp Annotation by Michelle Graham. GO Biological Process: ribosome biogenesis SoyBaseN/AISS
GO:0051567GO-bp Annotation by Michelle Graham. GO Biological Process: histone H3-K9 methylation SoyBaseN/AISS
GO:0005622GO-cc Annotation by Michelle Graham. GO Cellular Compartment: intracellular SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005840GO-cc Annotation by Michelle Graham. GO Cellular Compartment: ribosome SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0022625GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosolic large ribosomal subunit SoyBaseN/AISS
GO:0003735GO-mf Annotation by Michelle Graham. GO Molecular Function: structural constituent of ribosome SoyBaseN/AISS
KOG1696 KOG 60s ribosomal protein L19 JGI ISS
PTHR10722Panther 60S RIBOSOMAL PROTEIN L19 JGI ISS
PF01280PFAM Ribosomal protein L19e JGI ISS
UniRef100_C6TMH8UniRef Annotation by Michelle Graham. Most informative UniRef hit: Ribosomal protein L19 n=1 Tax=Glycine max RepID=C6TMH8_SOYBN SoyBaseE_val: 1.00E-150ISS
UniRef100_C6TMH8UniRef Annotation by Michelle Graham. Best UniRef hit: Ribosomal protein L19 n=1 Tax=Glycine max RepID=C6TMH8_SOYBN SoyBaseE_val: 1.00E-150ISS

Expression Patterns of Glyma02g01950
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma02g01950
ParalogEvidenceComments
Glyma10g02060 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma02g01950 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.02g016000 Wm82.a2.v1IGC As supplied by JGI

References for Glyma02g01950
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma02g01950
>Glyma02g01950.1   sequence type=CDS   gene model=Glyma02g01950   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGTGTCCTTGAAGCTTCAGAAGCGCCTCGCCGCTAGCGTCCTAAAGTGCGGCAAGGGCAAGGTCTGGCTTGATCCAAATGAAGTCAATGAAATCTCCATGGCCAATTCTCGACAAAACATAAGGAAGTTGGTTAAGGATGGGTTTATTATCAGGAAGCCGACTAAGATTCACTCTCGCTCCCGTGCTCGTCGAATGAAGGAGGCCAAGAGAAAGGGGCGTCACTCTGGTTATGGTAAGCGTAAGGGTACAAGGGAGGCAAGGCTTCCCACCAAAATCCTTTGGATGAGGAGGATGCGTGTCCTCAGGCGCTTGCTTCGCAAGTACAGGGAATCAAAGAAGATTGACAAGCACATGTACCATGACATGTACATGAAGGTGAAAGGTAATGTTTTCAAGAACAAGAGAGTCTTGATGGAGAGCATACACAAGTCCAAGGCTGAGAAGGCAAGAGAAAAGACATTGTCTGACCAGTTTGAGGCGAAGCGTGCCAAGAACAAGGCTAGCAGGGAGAGGAAAAATGCTCGGAGGGAGGAGCGCTTGGCCCAAGGTCCAGGAGAGAGGCCATCAGCAGCACAAACTACTACACCTGCAACAGCATCCCAGCCAGCTCAAGCACTGAAGAAATCCAAGAAGTGA
Predicted protein sequences of Glyma02g01950
>Glyma02g01950.1   sequence type=predicted peptide   gene model=Glyma02g01950   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MVSLKLQKRLAASVLKCGKGKVWLDPNEVNEISMANSRQNIRKLVKDGFIIRKPTKIHSRSRARRMKEAKRKGRHSGYGKRKGTREARLPTKILWMRRMRVLRRLLRKYRESKKIDKHMYHDMYMKVKGNVFKNKRVLMESIHKSKAEKAREKTLSDQFEAKRAKNKASRERKNARREERLAQGPGERPSAAQTTTPATASQPAQALKKSKK*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo