SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma02g01580

Feature Type:gene_model
Chromosome:Gm02
Start:1121493
stop:1122364
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma02g01580
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G62410AT Annotation by Michelle Graham. TAIR10: CP12 domain-containing protein 2 | chr3:23091006-23091401 FORWARD LENGTH=131 SoyBaseE_val: 4.00E-31ISS
GO:0009416GO-bp Annotation by Michelle Graham. GO Biological Process: response to light stimulus SoyBaseN/AISS
GO:0009637GO-bp Annotation by Michelle Graham. GO Biological Process: response to blue light SoyBaseN/AISS
GO:0009644GO-bp Annotation by Michelle Graham. GO Biological Process: response to high light intensity SoyBaseN/AISS
GO:0009744GO-bp Annotation by Michelle Graham. GO Biological Process: response to sucrose stimulus SoyBaseN/AISS
GO:0010114GO-bp Annotation by Michelle Graham. GO Biological Process: response to red light SoyBaseN/AISS
GO:0010155GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of proton transport SoyBaseN/AISS
GO:0010218GO-bp Annotation by Michelle Graham. GO Biological Process: response to far red light SoyBaseN/AISS
GO:0018316GO-bp Annotation by Michelle Graham. GO Biological Process: peptide cross-linking via L-cystine SoyBaseN/AISS
GO:0019253GO-bp Annotation by Michelle Graham. GO Biological Process: reductive pentose-phosphate cycle SoyBaseN/AISS
GO:0034605GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to heat SoyBaseN/AISS
GO:0070417GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to cold SoyBaseN/AISS
GO:0071454GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to anoxia SoyBaseN/AISS
GO:0080153GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of reductive pentose-phosphate cycle SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
PF02672PFAM CP12 domain JGI ISS
UniRef100_F1DT11UniRef Annotation by Michelle Graham. Most informative UniRef hit: Chloroplast protein 12 n=1 Tax=Stylosanthes guianensis RepID=F1DT11_9FABA SoyBaseE_val: 4.00E-46ISS
UniRef100_UPI00018C70EEUniRef Annotation by Michelle Graham. Best UniRef hit: UPI00018C70EE related cluster n=1 Tax=unknown RepID=UPI00018C70EE SoyBaseE_val: 2.00E-87ISS

Expression Patterns of Glyma02g01580
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma02g01580
ParalogEvidenceComments
Glyma10g01610 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma02g01580 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.02g012500 Wm82.a2.v1IGC As supplied by JGI

References for Glyma02g01580
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma02g01580
>Glyma02g01580.1   sequence type=CDS   gene model=Glyma02g01580   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCAACAATAGCTACTAGTGGTGTGAGTCTTTCAAGCCCTAGCACAGTACTTGCTATGAAATCAGACTCAGCACAAAAGGCCCAGGCCATGAGCTTCCCAGCTCTGTTCAGGCCCATTCAAAAGTGGCCCGGTTTGGTGAAGGCCCGGCCCGTTTGGGCCACGCCGGAGAAGATATCGGAGAAGGTGGAGGAGAGCATCAAGAGCGCGGAGGAGGCGTGCTCGGGAGCTGGCGGCGACGCAGAGTGCGCGGCGGCGTGGGACGAGGTGGAGGAGCTGAGCGCGGCGGCGAGCCACGCCAGGGAGAAGCAGAAGCAATCTGACCCGCTCGAGAACTACTGCAAGGACAACCCGGAGACCGATGAGTGCCGCACCTATGATAACTGA
Predicted protein sequences of Glyma02g01580
>Glyma02g01580.1   sequence type=predicted peptide   gene model=Glyma02g01580   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MATIATSGVSLSSPSTVLAMKSDSAQKAQAMSFPALFRPIQKWPGLVKARPVWATPEKISEKVEESIKSAEEACSGAGGDAECAAAWDEVEELSAAASHAREKQKQSDPLENYCKDNPETDECRTYDN*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo