SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma02g01530

Feature Type:gene_model
Chromosome:Gm02
Start:1094783
stop:1096342
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G03450AT Annotation by Michelle Graham. TAIR10: RGA-like 2 | chr3:819636-821279 REVERSE LENGTH=547 SoyBaseE_val: 5.00E-38ISS
GO:0009062GO-bp Annotation by Michelle Graham. GO Biological Process: fatty acid catabolic process SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009686GO-bp Annotation by Michelle Graham. GO Biological Process: gibberellin biosynthetic process SoyBaseN/AISS
GO:0009723GO-bp Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus SoyBaseN/AISS
GO:0009737GO-bp Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus SoyBaseN/AISS
GO:0009739GO-bp Annotation by Michelle Graham. GO Biological Process: response to gibberellin stimulus SoyBaseN/AISS
GO:0009740GO-bp Annotation by Michelle Graham. GO Biological Process: gibberellic acid mediated signaling pathway SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0009845GO-bp Annotation by Michelle Graham. GO Biological Process: seed germination SoyBaseN/AISS
GO:0009863GO-bp Annotation by Michelle Graham. GO Biological Process: salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009867GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:0009938GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of gibberellic acid mediated signaling pathway SoyBaseN/AISS
GO:0010029GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of seed germination SoyBaseN/AISS
GO:0010162GO-bp Annotation by Michelle Graham. GO Biological Process: seed dormancy process SoyBaseN/AISS
GO:0010187GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of seed germination SoyBaseN/AISS
GO:0010325GO-bp Annotation by Michelle Graham. GO Biological Process: raffinose family oligosaccharide biosynthetic process SoyBaseN/AISS
GO:0042538GO-bp Annotation by Michelle Graham. GO Biological Process: hyperosmotic salinity response SoyBaseN/AISS
GO:0048444GO-bp Annotation by Michelle Graham. GO Biological Process: floral organ morphogenesis SoyBaseN/AISS
GO:0048608GO-bp Annotation by Michelle Graham. GO Biological Process: reproductive structure development SoyBaseN/AISS
GO:2000033GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of seed dormancy process SoyBaseN/AISS
GO:2000377GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of reactive oxygen species metabolic process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
PF03514PFAM GRAS family transcription factor JGI ISS
UniRef100_G7ICX5UniRef Annotation by Michelle Graham. Most informative UniRef hit: GRAS family transcription factor n=1 Tax=Medicago truncatula RepID=G7ICX5_MEDTR SoyBaseE_val: 0ISS
UniRef100_I1JBF9UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JBF9_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma10g01571 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.02g012000 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma02g01530.2   sequence type=CDS   gene model=Glyma02g01530   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGTCACTAAGAGGGAGAAATAATTTACCTACAACTTCAGAGCAAAACCAGAAGCAGCAACATGATCTCAATTTTGATCCCTTGATGATCGAGGAGTTCAACTTTGAACCTATTCAACAACCAAAGCAGCCTCTTCAAGAAACTAAGGAACCAAAGAAGAATAAACAGGTTCTGCCATCTTCTTTAGCATCACTGGAGCTCTTGAGCAATTATGGAAGCAGCGATAGTTCTGTTCAAACTTGTGTGGGTCCTCAGAAGTTGTCAACTGAAGAAATAATGAGATTGGCTGGAGCAAGGTACATTCAGCACTCTACACAATTGTGTGATGATGTTTGCATCCCCGTGCACCCTTATGGATTTGGTCTTGGAGTTTTATCCCAGGAAGAAAATAGAGACATAGAACTCGCTCAGTTTCTTCTAGCAGCTGCTGAGAGGGTAGGGTGCCAACAATTTGAACGTGCCAGCATTTTACTCTCCTCCCATTTTCAGTGGAACTCTTCAGGTGATGGTGCCGTTCAGAGAGTTGTCTTTCATTTCGCTCAAGCATTACTAGAGAGAATCAGAAGAGAAACTGGAGGAAAGGTGACACTGAACAAGTGTGAGAAAAATTGTGAAAGGGAAATGTTTGAGAAGTTAAGATCGGATACTAACATGGCTGTTACATGCCATCAAAAAATTCCTTTCAATCAAGAGATGCAGTTTTCTGGGGTACAAGCTATAGTGGAAAATGTAACATCAAAAACCAAAGTTCATCTCATAAACTTTGATATTGGATGTGGGGTGCAATGCACGGCTTTGATGCAAGCACTGGCTGAGAGACAGGAAAAGCAAGTTGAACTTCTGAAGGTAACTGCCATTGGACTTCAAGGCAAGACCGAGCTAGAAGAGACAGGGAAAGGGTTAGTAGTTTTTGTCACAAGCATCATAGAGATCAAGGTAGAGCAATTTGGCATTGAAGATAATGAAGCTGTAGCTGTATATTCTCCTTATATGCTGAGGACTATGGTGTCGGATTCTGATTCCTTGGAACACTTGATGCGGGTGATGAGAAAAATCAGACCAAGTATAATGGTAGTTCTTGAGGTGGAAGCAATGCATAATTCACCCTCCTGTGTGAATCGCTTCATTGAGGCATTGTTCTTCTACGCAGCATTTTTTGACTGCATTGGGACCTGCATGAAGCAGGATCATGAATGCAGAATCAGAATTGAGGGAATATTATCTGAAGGGATACGAAACATTGTTGCAATGGAAGATGGAGAAAGGAAGGTTAGGAATGTGAAGATAGATGTTTGGAGAAGGTTCTTTGCAAGGTATAGAATGGTGGAGACTACATTTAGCGAGTCATCTTTGTACCAAGCTAACTTGGTTGCCAAAAAGTTTGCGTGTGGGAATTTCTGTACTGTGGATAGAAACGGGAAGTGTCTAATAGTTGGATGGAAGGGGACCCCAATTCATTCAATTTCAGTTTGGAAGTTTCTTTGA

>Glyma02g01530.2   sequence type=predicted peptide   gene model=Glyma02g01530   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MESLRGRNNLPTTSEQNQKQQHDLNFDPLMIEEFNFEPIQQPKQPLQETKEPKKNKQVLPSSLASLELLSNYGSSDSSVQTCVGPQKLSTEEIMRLAGARYIQHSTQLCDDVCIPVHPYGFGLGVLSQEENRDIELAQFLLAAAERVGCQQFERASILLSSHFQWNSSGDGAVQRVVFHFAQALLERIRRETGGKVTLNKCEKNCEREMFEKLRSDTNMAVTCHQKIPFNQEMQFSGVQAIVENVTSKTKVHLINFDIGCGVQCTALMQALAERQEKQVELLKVTAIGLQGKTELEETGKGLVVFVTSIIEIKVEQFGIEDNEAVAVYSPYMLRTMVSDSDSLEHLMRVMRKIRPSIMVVLEVEAMHNSPSCVNRFIEALFFYAAFFDCIGTCMKQDHECRIRIEGILSEGIRNIVAMEDGERKVRNVKIDVWRRFFARYRMVETTFSESSLYQANLVAKKFACGNFCTVDRNGKCLIVGWKGTPIHSISVWKFL*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo