SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma02g01170): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma02g01170): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma02g01170

Feature Type:gene_model
Chromosome:Gm02
Start:879704
stop:880785
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G01850AT Annotation by Michelle Graham. TAIR10: S-adenosylmethionine synthetase 2 | chr4:796298-797479 REVERSE LENGTH=393 SoyBaseE_val: 2.00E-145ISS
GO:0006556GO-bp Annotation by Michelle Graham. GO Biological Process: S-adenosylmethionine biosynthetic process SoyBaseN/AISS
GO:0006970GO-bp Annotation by Michelle Graham. GO Biological Process: response to osmotic stress SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0071281GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to iron ion SoyBaseN/AISS
GO:0005618GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cell wall SoyBaseN/AISS
GO:0005730GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleolus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0070062GO-cc Annotation by Michelle Graham. GO Cellular Compartment: extracellular vesicular exosome SoyBaseN/AISS
GO:0004478GO-mf Annotation by Michelle Graham. GO Molecular Function: methionine adenosyltransferase activity SoyBaseN/AISS
GO:0005507GO-mf Annotation by Michelle Graham. GO Molecular Function: copper ion binding SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
KOG1506 KOG S-adenosylmethionine synthetase JGI ISS
PTHR11964Panther S-ADENOSYLMETHIONINE SYNTHETASE JGI ISS
PF00438PFAM S-adenosylmethionine synthetase, N-terminal domain JGI ISS
PF02772PFAM S-adenosylmethionine synthetase, central domain JGI ISS
PF02773PFAM S-adenosylmethionine synthetase, C-terminal domain JGI ISS
UniRef100_I1JBB9UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1JBB9_SOYBN SoyBaseE_val: 0ISS
UniRef100_I1NBG9UniRef Annotation by Michelle Graham. Most informative UniRef hit: S-adenosylmethionine synthase n=1 Tax=Glycine max RepID=I1NBG9_SOYBN SoyBaseE_val: 2.00E-148ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma02g01170 not represented in the dataset

Glyma02g01170 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma02g01170.1   sequence type=CDS   gene model=Glyma02g01170   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
AGACATTTCTATTCACCTCTGAATCTGTCAACGAGGGACTCCCTGACAAGCTGTGCGTGCGACCATATCTCTGATGCAGTGCTCGATGCCTGCCTTGAACAGGATCCTGACAGCAAGGTTGCCTGTGAGACATGCACCAAGACTAACATGATCATGGTCTTTGGAGAGATTACAACCGAGGCCAACGTAGACTATGAACACATGCCGCAACACAAATGCAAGGTGTTGGTCAACATTGAGCAGCAGAGCCCTGATATTGCTCAGGGAGTGCATGGCCACTTCACCAAGCGCCCAGAAGAAGTTGGTGCCGGTGACAGGGTCACATTGACAGTAGAGTACTACAATGAGAATGGTGCCATGGTTCCAGTTTGTGTCCACACTGTCCTAATTTCCACTCAGCATGATGAGACTGAGCATGTTATCAAGCCTGTGATTCCTGAGAAGTACTTGGATGACAAGACCATCTTCCACCTTAACCCTTCTGGTAGATTTGTCATTGGTGGCCCTCATGGTGATGCTGGTCTTACCGGAAGAAAGATTATCATTGATACTTATTGTGGCTGGGGTGCACATGGAGGTGGTGCTTTCTCAGGAAAGGACCCTACTAAGGTTGATAGAAGTGGTGCCTATGTTGCAAGGCAGCAGCAAAGATTTCTTATGCCATTGGTGTTCCTGAGCCTTTGTCAGTTTGGAACTGGAAAGATTCCAGACAAGGAGATTCTTCAGCTTGTGAAGAAGAATTTTGACTTTAGGCCTGGGATGATCACCATTAACTTGGACCTTAAGAGGGGTGGCCATAGGTTCCTCAAGACAGCTGCCTATGGACACTTTGGAAGGGAGGATCCAGACTTCACCTGGGAAGTTGTTAAGCCACTCAAGTGGGACAAGCCTCAAGCT

>Glyma02g01170.1   sequence type=predicted peptide   gene model=Glyma02g01170   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
RHFYSPLNLSTRDSLTSCACDHISDAVLDACLEQDPDSKVACETCTKTNMIMVFGEITTEANVDYEHMPQHKCKVLVNIEQQSPDIAQGVHGHFTKRPEEVGAGDRVTLTVEYYNENGAMVPVCVHTVLISTQHDETEHVIKPVIPEKYLDDKTIFHLNPSGRFVIGGPHGDAGLTGRKIIIDTYCGWGAHGGGAFSGKDPTKVDRSGAYVARQQQRFLMPLVFLSLCQFGTGKIPDKEILQLVKKNFDFRPGMITINLDLKRGGHRFLKTAAYGHFGREDPDFTWEVVKPLKWDKPQA







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo