Glyma02g01170 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma02g01170): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma02g01170): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma02g01170

Feature Type:	gene_model
Chromosome:	Gm02
Start:	879704
stop:	880785
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma02g01170

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G01850	AT	Annotation by Michelle Graham. TAIR10: S-adenosylmethionine synthetase 2 \| chr4:796298-797479 REVERSE LENGTH=393	SoyBase	E_val: 2.00E-145	ISS
GO:0006556	GO-bp	Annotation by Michelle Graham. GO Biological Process: S-adenosylmethionine biosynthetic process	SoyBase	N/A	ISS
GO:0006970	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to osmotic stress	SoyBase	N/A	ISS
GO:0046686	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to cadmium ion	SoyBase	N/A	ISS
GO:0071281	GO-bp	Annotation by Michelle Graham. GO Biological Process: cellular response to iron ion	SoyBase	N/A	ISS
GO:0005618	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cell wall	SoyBase	N/A	ISS
GO:0005730	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleolus	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0005829	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosol	SoyBase	N/A	ISS
GO:0009506	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma	SoyBase	N/A	ISS
GO:0070062	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: extracellular vesicular exosome	SoyBase	N/A	ISS
GO:0004478	GO-mf	Annotation by Michelle Graham. GO Molecular Function: methionine adenosyltransferase activity	SoyBase	N/A	ISS
GO:0005507	GO-mf	Annotation by Michelle Graham. GO Molecular Function: copper ion binding	SoyBase	N/A	ISS
GO:0005524	GO-mf	Annotation by Michelle Graham. GO Molecular Function: ATP binding	SoyBase	N/A	ISS
KOG1506	KOG	S-adenosylmethionine synthetase	JGI		ISS
PTHR11964	Panther	S-ADENOSYLMETHIONINE SYNTHETASE	JGI		ISS
PF00438	PFAM	S-adenosylmethionine synthetase, N-terminal domain	JGI		ISS
PF02772	PFAM	S-adenosylmethionine synthetase, central domain	JGI		ISS
PF02773	PFAM	S-adenosylmethionine synthetase, C-terminal domain	JGI		ISS
UniRef100_I1JBB9	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1JBB9_SOYBN	SoyBase	E_val: 0	ISS
UniRef100_I1NBG9	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: S-adenosylmethionine synthase n=1 Tax=Glycine max RepID=I1NBG9_SOYBN	SoyBase	E_val: 2.00E-148	ISS

Expression Patterns of Glyma02g01170

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma02g01170 not represented in the dataset	Glyma02g01170 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma02g01170 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma02g01170

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma02g01170

Limit To All Plant Sequences

>Glyma02g01170.1   sequence type=CDS   gene model=Glyma02g01170   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
AGACATTTCTATTCACCTCTGAATCTGTCAACGAGGGACTCCCTGACAAGCTGTGCGTGCGACCATATCTCTGATGCAGTGCTCGATGCCTGCCTTGAACAGGATCCTGACAGCAAGGTTGCCTGTGAGACATGCACCAAGACTAACATGATCATGGTCTTTGGAGAGATTACAACCGAGGCCAACGTAGACTATGAACACATGCCGCAACACAAATGCAAGGTGTTGGTCAACATTGAGCAGCAGAGCCCTGATATTGCTCAGGGAGTGCATGGCCACTTCACCAAGCGCCCAGAAGAAGTTGGTGCCGGTGACAGGGTCACATTGACAGTAGAGTACTACAATGAGAATGGTGCCATGGTTCCAGTTTGTGTCCACACTGTCCTAATTTCCACTCAGCATGATGAGACTGAGCATGTTATCAAGCCTGTGATTCCTGAGAAGTACTTGGATGACAAGACCATCTTCCACCTTAACCCTTCTGGTAGATTTGTCATTGGTGGCCCTCATGGTGATGCTGGTCTTACCGGAAGAAAGATTATCATTGATACTTATTGTGGCTGGGGTGCACATGGAGGTGGTGCTTTCTCAGGAAAGGACCCTACTAAGGTTGATAGAAGTGGTGCCTATGTTGCAAGGCAGCAGCAAAGATTTCTTATGCCATTGGTGTTCCTGAGCCTTTGTCAGTTTGGAACTGGAAAGATTCCAGACAAGGAGATTCTTCAGCTTGTGAAGAAGAATTTTGACTTTAGGCCTGGGATGATCACCATTAACTTGGACCTTAAGAGGGGTGGCCATAGGTTCCTCAAGACAGCTGCCTATGGACACTTTGGAAGGGAGGATCCAGACTTCACCTGGGAAGTTGTTAAGCCACTCAAGTGGGACAAGCCTCAAGCT

Predicted protein sequences of Glyma02g01170

Limit To All Plant Sequences

>Glyma02g01170.1   sequence type=predicted peptide   gene model=Glyma02g01170   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
RHFYSPLNLSTRDSLTSCACDHISDAVLDACLEQDPDSKVACETCTKTNMIMVFGEITTEANVDYEHMPQHKCKVLVNIEQQSPDIAQGVHGHFTKRPEEVGAGDRVTLTVEYYNENGAMVPVCVHTVLISTQHDETEHVIKPVIPEKYLDDKTIFHLNPSGRFVIGGPHGDAGLTGRKIIIDTYCGWGAHGGGAFSGKDPTKVDRSGAYVARQQQRFLMPLVFLSLCQFGTGKIPDKEILQLVKKNFDFRPGMITINLDLKRGGHRFLKTAAYGHFGREDPDFTWEVVKPLKWDKPQA

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain