Glyma02g01020 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma02g01020

Feature Type:	gene_model
Chromosome:	Gm02
Start:	764691
stop:	766752
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma02g01020

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G02360	AT	Annotation by Michelle Graham. TAIR10: Chitinase family protein \| chr1:472138-473116 REVERSE LENGTH=272	SoyBase	E_val: 8.00E-147	ISS
GO:0002679	GO-bp	Annotation by Michelle Graham. GO Biological Process: respiratory burst involved in defense response	SoyBase	N/A	ISS
GO:0005975	GO-bp	Annotation by Michelle Graham. GO Biological Process: carbohydrate metabolic process	SoyBase	N/A	ISS
GO:0006865	GO-bp	Annotation by Michelle Graham. GO Biological Process: amino acid transport	SoyBase	N/A	ISS
GO:0010167	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to nitrate	SoyBase	N/A	ISS
GO:0010200	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to chitin	SoyBase	N/A	ISS
GO:0015706	GO-bp	Annotation by Michelle Graham. GO Biological Process: nitrate transport	SoyBase	N/A	ISS
GO:0016998	GO-bp	Annotation by Michelle Graham. GO Biological Process: cell wall macromolecule catabolic process	SoyBase	N/A	ISS
GO:0050832	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response to fungus	SoyBase	N/A	ISS
GO:0005576	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: extracellular region	SoyBase	N/A	ISS
GO:0004568	GO-mf	Annotation by Michelle Graham. GO Molecular Function: chitinase activity	SoyBase	N/A	ISS
KOG4742	KOG	Predicted chitinase	JGI		ISS
PTHR22595	Panther	CHITINASE-RELATED	JGI		ISS
PTHR22595:SF11	Panther	CLASS I CHITINASE	JGI		ISS
PF00182	PFAM	Chitinase class I	JGI		ISS
UniRef100_D8V5S2	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Class II chitinase n=1 Tax=Arachis hypogaea RepID=D8V5S2_ARAHY	SoyBase	E_val: 2.00E-163	ISS
UniRef100_I1JBA3	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JBA3_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma02g01020

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma02g01020 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.02g007400	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma02g01020

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma02g01020

Limit To All Plant Sequences

>Glyma02g01020.1   sequence type=CDS   gene model=Glyma02g01020   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCATTCTTATTCTTCCCCTCTAAGGGTATCTTTCTCTCTAGCTTTTTGTTATGCTTTGCTATTCTGTCTTTGGGAGCTGAAGCTCGTAGATCACCATCACCCATCTCTTCTCTCATTAGCAAAGAGCTTTTTGATTCCATTTTCATCCACAAAGATAACAATGCATGCCCTGCCAGAAACTTCTACACCTACGACTCCTTCATCAATGCATCCAAACGCTTCCCAAGATTTGGCACCACTGGTAGTCCAGCCACACGCAAGCGTGAGATTGCTGCCTTTCTTGCTCAGATTTCACATGAAACCACAGGTGGGTGGGCTACTGCACCTGATGGACCCTATGCTTGGGGATTGTGCTTCAAGGAAGAAATTAGTCCTCAAAGTAACTATTGTGATTCCACCAACACACAATGGCCTTGTTATCCAGGACAAAGTTACAAAGGCAGAGGACCAATTCAACTCTCATGGAACTACAACTATGGGCCAGCAGGGAAGGCTTTGGGATTTGATGGGTTGAGAAACCCGGATGTGGTGTCAAACAATTCATTGATTGCCTTTCAAACAGGTCTCTGGTTTTGGATGACAGAGCAAAAGCCCAAACCTTCTTGCCACAATGTAATGGTTGGAAAATATGTGCCAACACAAGCTGACATAGCAGCTAATCGAACTAAAGGGTATGGCCTAGTGACTAACATAATCAATGGTGGACTTGAATGTGGAATTCCTGATGATTCAAGGGTGAATGATCGGATTGAATACTTTAAGAGATATGCAACCTTGTTTAAAGTAGATACAGGACCTAACTTGGATTGTGCATATCAGAAGTCTTTCCAAACTGTAGCTTAG

Predicted protein sequences of Glyma02g01020

Limit To All Plant Sequences

>Glyma02g01020.1   sequence type=predicted peptide   gene model=Glyma02g01020   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAFLFFPSKGIFLSSFLLCFAILSLGAEARRSPSPISSLISKELFDSIFIHKDNNACPARNFYTYDSFINASKRFPRFGTTGSPATRKREIAAFLAQISHETTGGWATAPDGPYAWGLCFKEEISPQSNYCDSTNTQWPCYPGQSYKGRGPIQLSWNYNYGPAGKALGFDGLRNPDVVSNNSLIAFQTGLWFWMTEQKPKPSCHNVMVGKYVPTQADIAANRTKGYGLVTNIINGGLECGIPDDSRVNDRIEYFKRYATLFKVDTGPNLDCAYQKSFQTVA*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain