Glyma02g01010 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma02g01010

Feature Type:	gene_model
Chromosome:	Gm02
Start:	761829
stop:	763425
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma02g01010

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G62100	AT	Annotation by Michelle Graham. TAIR10: indole-3-acetic acid inducible 30 \| chr3:22995835-22996593 FORWARD LENGTH=172	SoyBase	E_val: 6.00E-40	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0009630	GO-bp	Annotation by Michelle Graham. GO Biological Process: gravitropism	SoyBase	N/A	ISS
GO:0009733	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus	SoyBase	N/A	ISS
GO:0010262	GO-bp	Annotation by Michelle Graham. GO Biological Process: somatic embryogenesis	SoyBase	N/A	ISS
GO:0010583	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to cyclopentenone	SoyBase	N/A	ISS
GO:0048364	GO-bp	Annotation by Michelle Graham. GO Biological Process: root development	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003700	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity	SoyBase	N/A	ISS
GO:0046983	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein dimerization activity	SoyBase	N/A	ISS
PF02309	PFAM	AUX/IAA family	JGI		ISS
UniRef100_I1JBA2	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JBA2_SOYBN	SoyBase	E_val: 6.00E-130	ISS
UniRef100_Q8RVH6	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Aux/IAA protein n=1 Tax=Populus tremula x Populus tremuloides RepID=Q8RVH6_9ROSI	SoyBase	E_val: 6.00E-55	ISS

Expression Patterns of Glyma02g01010

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma02g01010 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.02g007300	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma02g01010

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma02g01010

Limit To All Plant Sequences

>Glyma02g01010.1   sequence type=CDS   gene model=Glyma02g01010   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGCAAAGCCTCTAGTTCTTCCTCCTCTTCTATCTCCAGCTGCAGAAACCCTTCCAATTATTCAACTGCATCCTCTCTCACACACCAACATAGTGATCAAGACCACCTTCGCACAGATCTTAGGCTTGGACTAAGCATTTCCACTACTCATGATCAACATGTTGGCTCTTCTAGTTCAGGGGGGCACTGGCAACCGATGCAGCCACATCTAAGTAGTTTTTCACAAGCTACTGAAGTGAATCATTGCAGTGATCATACCAGCTTCTTTGTGAAGGTGTACATGGAAGGCATTCCGATTGGTAGAAAACTCAACCTGTTAGCTCATGATGGCTACCACGAGTTAGTAAAGACCCTTGAACAGATGTTTGACACTACCATTTTGTGGGGAACTGAAATGGACGGAGTGCAACCAGATAGGTGCCATGTTCTAACTTATGAAGATGGAGAAGGAGATTTGATTATGGTTGGGGATGTCCCTTGGGAGATGTTCTTATCAGCTGTAAAGAGGTTGAAGATCACAAGGGTGGAGACATTCGGGTGA

Predicted protein sequences of Glyma02g01010

Limit To All Plant Sequences

>Glyma02g01010.1   sequence type=predicted peptide   gene model=Glyma02g01010   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGKASSSSSSSISSCRNPSNYSTASSLTHQHSDQDHLRTDLRLGLSISTTHDQHVGSSSSGGHWQPMQPHLSSFSQATEVNHCSDHTSFFVKVYMEGIPIGRKLNLLAHDGYHELVKTLEQMFDTTILWGTEMDGVQPDRCHVLTYEDGEGDLIMVGDVPWEMFLSAVKRLKITRVETFG*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain