SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma02g00380

Feature Type:gene_model
Chromosome:Gm02
Start:175294
stop:178653
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma02g00380
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G26640AT Annotation by Michelle Graham. TAIR10: 3-ketoacyl-CoA synthase 11 | chr2:11330094-11331623 FORWARD LENGTH=509 SoyBaseE_val: 0ISS
GO:0006084GO-bp Annotation by Michelle Graham. GO Biological Process: acetyl-CoA metabolic process SoyBaseN/AISS
GO:0006633GO-bp Annotation by Michelle Graham. GO Biological Process: fatty acid biosynthetic process SoyBaseN/AISS
GO:0006816GO-bp Annotation by Michelle Graham. GO Biological Process: calcium ion transport SoyBaseN/AISS
GO:0007030GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi organization SoyBaseN/AISS
GO:0008152GO-bp Annotation by Michelle Graham. GO Biological Process: metabolic process SoyBaseN/AISS
GO:0008610GO-bp Annotation by Michelle Graham. GO Biological Process: lipid biosynthetic process SoyBaseN/AISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0009416GO-bp Annotation by Michelle Graham. GO Biological Process: response to light stimulus SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009832GO-bp Annotation by Michelle Graham. GO Biological Process: plant-type cell wall biogenesis SoyBaseN/AISS
GO:0016049GO-bp Annotation by Michelle Graham. GO Biological Process: cell growth SoyBaseN/AISS
GO:0016126GO-bp Annotation by Michelle Graham. GO Biological Process: sterol biosynthetic process SoyBaseN/AISS
GO:0016132GO-bp Annotation by Michelle Graham. GO Biological Process: brassinosteroid biosynthetic process SoyBaseN/AISS
GO:0030243GO-bp Annotation by Michelle Graham. GO Biological Process: cellulose metabolic process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0003824GO-mf Annotation by Michelle Graham. GO Molecular Function: catalytic activity SoyBaseN/AISS
GO:0016747GO-mf Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring acyl groups other than amino-acyl groups SoyBaseN/AISS
PF08392PFAM FAE1/Type III polyketide synthase-like protein JGI ISS
PF08541PFAM 3-Oxoacyl-[acyl-carrier-protein (ACP)] synthase III C terminal JGI ISS
UniRef100_I1JB48UniRef Annotation by Michelle Graham. Most informative UniRef hit: 3-ketoacyl-CoA synthase n=1 Tax=Glycine max RepID=I1JB48_SOYBN SoyBaseE_val: 0ISS
UniRef100_I1JB48UniRef Annotation by Michelle Graham. Best UniRef hit: 3-ketoacyl-CoA synthase n=1 Tax=Glycine max RepID=I1JB48_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma02g00380
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma02g00380
ParalogEvidenceComments
Glyma10g00440 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma02g00380 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.02g001500 Wm82.a2.v1IGC As supplied by JGI

References for Glyma02g00380
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma02g00380
>Glyma02g00380.1   sequence type=CDS   gene model=Glyma02g00380   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTGACCAGAAGAATCAAAACCCGGATTCAGGAACCATTAGTGTTGAATCAGCAAAAGAAAAAAGAAGGAACAAACTTCCCAACTTCCTGCTATCAGTGAGACTCAAGTATGTGAAGCTAGGGTACCATTACGTAATCTCCAATGCAATGTACCTTCTGCTCATACCCCTTCTAGGCATAGCTTCGGCTCATCTTTCAACCCTTTCCATCAAGGACTTTCTCCAATTATGGGAGAATCTCAAGTTCAACCTTGTCTCGGTAACCCTATGTTCAAGCCTCACGGTGTTCCTCGCCACCCTCTACTTCATGACCCGTCCAAGGGGGGTGTACTTAGTAGATTTTGCATGCTACAAGCCTGACGTGGATTGCACGTGCACGCGGGAGATTTTCGTGGAGAGGTCTGGTCTCACAGGCTCATTCTCGGAGGAGAACTTGTCCTTTCAGAAGAAGATCCTTGAGAGGTCTGGTTTGGGGCAGAAGACGTATCTTCCGCCCGCAATCTTGAGTTTGCCGCCGCGACCGTGCATGGCGGCGGCCAGGGAGGAGGCTGAGCAAGTCATGTTTGGAGCAATTGACCAGCTGCTGGCAAAGACTGGTGTGAAGGCTAAGGATATTGGGATCTTGGTGGTCAATTGCAGCTTGTTCAACCCCACACCTTCACTCTCTGCCATGATTGTCAATCACTACAAGTTGAGAGGGAATGTTTTCAGTTATAATCTTGGTGGCATGGGTTGCAGTGCTGGCCTTATCTCTATTGACCTTGCCAAGCACCTCCTCCAGGTCCATCCCAACTCTTATGCCTTGGTAGTGAGCATGGAGAACATCACTCTGAACTGGTATTTTGGCAACAACCGGTCAATGCTAGTCTCAAACTGTCTCTTCAGAATGGGAGGAGCAGCAATCCTCCTCTCCAACCGCTCCGGCGACCGCCACCGCGCCAAATACCAACTAGTCCACACAGTGCGGACTCACAAAGGAGCAGATGACAAGTCCTACGGCTGTGTCTTCCAAGAAGAAGATGAGACAAAAAGAATTGGTGTGGCACTCTCAAAAGACCTAATGGCTGTGGCAGGAGAGGCCCTAAAGACCAACATCACAACACTAGGACCCTTGGTCCTCCCTATGTCAGAACAGCTTCTTTTCTTTGCCACATTGGTGGCTAGGAAAGTGTTCAAGATGAAGATAAAACCATACATCCCAGATTTCAAGTTGGCCTTTGAGCATTTTTGCATTCATGCTGGAGGGAGGGCAGTGTTGGATGAGTTGGAGAAGAATCTTGAGCTCTCTGATTGGCACATGGAGCCCTCAAGGATGACACTAAATAGGTTTGGTAACACTTCTAGCAGTTCCTTGTGGTATGAATTGGCCTACACTGAAGCCAAAGGGAGGATCAAGAAAGGTGACAGGACTTGGCAGATTGCATTTGGGTCAGGGTTTAAGTGCAACAGTGCTGTGTGGAGGGCTTTGAGGACCATCAATCCTGCTAAGGAGAAAAATCCTTGGATGGATGAGATTCATGAGTTTCCTGTTCATGTGCCTAAAGTGGCACCAATTGCTTCCTAA
Predicted protein sequences of Glyma02g00380
>Glyma02g00380.1   sequence type=predicted peptide   gene model=Glyma02g00380   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MADQKNQNPDSGTISVESAKEKRRNKLPNFLLSVRLKYVKLGYHYVISNAMYLLLIPLLGIASAHLSTLSIKDFLQLWENLKFNLVSVTLCSSLTVFLATLYFMTRPRGVYLVDFACYKPDVDCTCTREIFVERSGLTGSFSEENLSFQKKILERSGLGQKTYLPPAILSLPPRPCMAAAREEAEQVMFGAIDQLLAKTGVKAKDIGILVVNCSLFNPTPSLSAMIVNHYKLRGNVFSYNLGGMGCSAGLISIDLAKHLLQVHPNSYALVVSMENITLNWYFGNNRSMLVSNCLFRMGGAAILLSNRSGDRHRAKYQLVHTVRTHKGADDKSYGCVFQEEDETKRIGVALSKDLMAVAGEALKTNITTLGPLVLPMSEQLLFFATLVARKVFKMKIKPYIPDFKLAFEHFCIHAGGRAVLDELEKNLELSDWHMEPSRMTLNRFGNTSSSSLWYELAYTEAKGRIKKGDRTWQIAFGSGFKCNSAVWRALRTINPAKEKNPWMDEIHEFPVHVPKVAPIAS*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo