SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma01g42211): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma01g42211): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma01g42211

Feature Type:gene_model
Chromosome:Gm01
Start:53514549
stop:53518293
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G12060AT Annotation by Michelle Graham. TAIR10: Double Clp-N motif protein | chr4:7228269-7229898 REVERSE LENGTH=241 SoyBaseE_val: 3.00E-76ISS
GO:0006569GO-bp Annotation by Michelle Graham. GO Biological Process: tryptophan catabolic process SoyBaseN/AISS
GO:0009684GO-bp Annotation by Michelle Graham. GO Biological Process: indoleacetic acid biosynthetic process SoyBaseN/AISS
GO:0019538GO-bp Annotation by Michelle Graham. GO Biological Process: protein metabolic process SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009532GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plastid stroma SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
GO:0043424GO-mf Annotation by Michelle Graham. GO Molecular Function: protein histidine kinase binding SoyBaseN/AISS
PTHR11638Panther ATP-DEPENDENT CLP PROTEASE JGI ISS
PTHR11638:SF62Panther SUBFAMILY NOT NAMED JGI ISS
PF02861PFAM Clp amino terminal domain JGI ISS
UniRef100_G7KG47UniRef Annotation by Michelle Graham. Most informative UniRef hit: ATP-dependent Clp protease ATP-binding subunit clpA-like protein n=1 Tax=Medicago truncatula RepID=G7KG47_MEDTR SoyBaseE_val: 2.00E-96ISS
UniRef100_UPI0002337AF0UniRef Annotation by Michelle Graham. Best UniRef hit: UPI0002337AF0 related cluster n=1 Tax=unknown RepID=UPI0002337AF0 SoyBaseE_val: 8.00E-132ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma01g42211 not represented in the dataset

Glyma01g42211 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.01g212900 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma01g42211.1   sequence type=CDS   gene model=Glyma01g42211   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTTTCTTCCGCTTAAAACATCTTTATTCAGTTCCAAACTCGCATTAATTTTTGTTGTGAAATGGCTGTTTCGCGCTGCCATTGCCCCGCGAGTCTGGTATTCCGCTCCGACCGACTCTAGTGTTCGTTTGGGTCAGACTTTGACGCTAAAGAGCTTCGAGAATTCATGGATTGGAACTAAAGTTGGGGTTTCGCCATGCAGTCTCAATCTTAGACCTGTCGTGTCCGTTTCCCGGCGGCGCCCGCTCGCTGCTACCGTCTCCTTCAGCCTCCCCACCGCAAAGCCAGAGCGTGCTTCTACTGGCCAAGAAATTCCCAAATGGTTTTCCAAGGCTATAAAATCATTTGCAATGTCTGAATTGGAGGCAAGAAAACTGAAGTATCTGACCACTGGCACTGAAGCCCTTCTCATGGGGGTTCTCATTGAGAGTACTAATCTAACTGCTAAGTTTTTGCGAGCCCATGGAATTACAATTCTCAAGGTGCGTGATGAAACTGTGAAGTTACTTGGAAAAGCTGATTTGTTTTTCTTCAGCCCAGAGCATCCTCCACTGACTGATGAAGCTCAGAGGGCCCTTGATTGGGCTGTTGATCAAAAAATAAAATATGGTGATGGCGGGGAAATTACCACTTCACACATACTTCTTGGCATTTGGTCTGAAGTGGATTCTCCTGGTCACAAGATTCTGTTTACTCTTGGCTTTAATGATGAAAAAGCTAAAGAGCTTGAGCCCTCAATTTCTAAACCTGGATGTACGGATGATTGA

>Glyma01g42211.1   sequence type=predicted peptide   gene model=Glyma01g42211   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MFLPLKTSLFSSKLALIFVVKWLFRAAIAPRVWYSAPTDSSVRLGQTLTLKSFENSWIGTKVGVSPCSLNLRPVVSVSRRRPLAATVSFSLPTAKPERASTGQEIPKWFSKAIKSFAMSELEARKLKYLTTGTEALLMGVLIESTNLTAKFLRAHGITILKVRDETVKLLGKADLFFFSPEHPPLTDEAQRALDWAVDQKIKYGDGGEITTSHILLGIWSEVDSPGHKILFTLGFNDEKAKELEPSISKPGCTDD*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo