Report for Sequence Feature Glyma01g41550
Feature Type: gene_model
Chromosome: Gm01
Start: 53018719
stop: 53022406
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma01g41550
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT5G47310 AT
Annotation by Michelle Graham. TAIR10: PPPDE putative thiol peptidase family protein | chr5:19201325-19202674 FORWARD LENGTH=245
SoyBase E_val: 6.00E-101 ISS
GO:0008150 GO-bp
Annotation by Michelle Graham. GO Biological Process: biological process
SoyBase N/A ISS
GO:0005737 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm
SoyBase N/A ISS
GO:0003674 GO-mf
Annotation by Michelle Graham. GO Molecular Function: molecular function
SoyBase N/A ISS
KOG0324
KOG
Uncharacterized conserved protein
JGI ISS
PTHR12378 Panther
UNCHARACTERIZED
JGI ISS
PF05903 PFAM
PPPDE putative peptidase domain
JGI ISS
UniRef100_C6TAJ5 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6TAJ5_SOYBN
SoyBase E_val: 9.00E-166 ISS
UniRef100_G7JHP3 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: EREBP-4 like protein n=1 Tax=Medicago truncatula RepID=G7JHP3_MEDTR
SoyBase E_val: 6.00E-100 ISS
Expression Patterns of Glyma01g41550
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma01g41550
Paralog Evidence Comments
Glyma11g03880 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma01g41550 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.01g207000 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma01g41550
Coding sequences of Glyma01g41550
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma01g41550.1 sequence type=CDS gene model=Glyma01g41550 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGCGTTGGTTTCCGTTGAGTACAACTTCAAACTCGGAGAGAGAACGGAATAGAGAGAACACTACTCGTGCTTCGGTGTATCTCAATGTATATGATCTTACTCCCATAAACAATTACCTTTACATGCTTGGCCTTGGAATTTTTCATTCGGGTATACAAGTGCATGATATTGAATATGGCTTTGGGGCACATGAATATCCAAGTAGTGGTGTGTTTGAGGTGGAACCTAGAAGCTGCCCTGGCTTCATCTTTAGACGATCAGTGTTGTTGGGCAGCACTGATATGTCTAACTCAGAATTTCGATATTTCATAGAGCGCCTGTCTGCAAAATATCATGGAGACACTTATCATCTTATTGCCAAAAACTGCAACCATTTTACGGATGAAGTTTGCCAGCATCTAACAGGAAGTCCTATCCCTGGATGGGTAAATCGGATGGCTCGTGTAGGTTCTTTCTGCAATTGTCTTCTGCCAGAAAGCCTCCAGGTTGCTGCAGTTAGACATCTCCCTGAACGTGTTGCATTTGATGATGATGATGGATCAGGATCTGATGGCCTTTCTGCATCCATTGAGAGTGAAGAAGATGAGCCCAATCACCATTTTTTAACTTCACCAAATGGTGATGTTGCCTTTCTAAAGGAAAAACCAGTTAGGCTGGCACGGGAGCACTTATGA
Predicted protein sequences of Glyma01g41550
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma01g41550.1 sequence type=predicted peptide gene model=Glyma01g41550 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MRWFPLSTTSNSERERNRENTTRASVYLNVYDLTPINNYLYMLGLGIFHSGIQVHDIEYGFGAHEYPSSGVFEVEPRSCPGFIFRRSVLLGSTDMSNSEFRYFIERLSAKYHGDTYHLIAKNCNHFTDEVCQHLTGSPIPGWVNRMARVGSFCNCLLPESLQVAAVRHLPERVAFDDDDGSGSDGLSASIESEEDEPNHHFLTSPNGDVAFLKEKPVRLAREHL*