Glyma01g41320 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma01g41320): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma01g41320): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma01g41320

Feature Type:	gene_model
Chromosome:	Gm01
Start:	52855174
stop:	52856602
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma01g41320

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G17600	AT	Annotation by Michelle Graham. TAIR10: Chlorophyll A-B binding family protein \| chr4:9803759-9804714 FORWARD LENGTH=262	SoyBase	E_val: 3.00E-84	ISS
GO:0006098	GO-bp	Annotation by Michelle Graham. GO Biological Process: pentose-phosphate shunt	SoyBase	N/A	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0006364	GO-bp	Annotation by Michelle Graham. GO Biological Process: rRNA processing	SoyBase	N/A	ISS
GO:0006417	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of translation	SoyBase	N/A	ISS
GO:0009637	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to blue light	SoyBase	N/A	ISS
GO:0009657	GO-bp	Annotation by Michelle Graham. GO Biological Process: plastid organization	SoyBase	N/A	ISS
GO:0009902	GO-bp	Annotation by Michelle Graham. GO Biological Process: chloroplast relocation	SoyBase	N/A	ISS
GO:0009965	GO-bp	Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis	SoyBase	N/A	ISS
GO:0010027	GO-bp	Annotation by Michelle Graham. GO Biological Process: thylakoid membrane organization	SoyBase	N/A	ISS
GO:0010103	GO-bp	Annotation by Michelle Graham. GO Biological Process: stomatal complex morphogenesis	SoyBase	N/A	ISS
GO:0010114	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to red light	SoyBase	N/A	ISS
GO:0010207	GO-bp	Annotation by Michelle Graham. GO Biological Process: photosystem II assembly	SoyBase	N/A	ISS
GO:0010218	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to far red light	SoyBase	N/A	ISS
GO:0015979	GO-bp	Annotation by Michelle Graham. GO Biological Process: photosynthesis	SoyBase	N/A	ISS
GO:0015995	GO-bp	Annotation by Michelle Graham. GO Biological Process: chlorophyll biosynthetic process	SoyBase	N/A	ISS
GO:0019288	GO-bp	Annotation by Michelle Graham. GO Biological Process: isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway	SoyBase	N/A	ISS
GO:0030154	GO-bp	Annotation by Michelle Graham. GO Biological Process: cell differentiation	SoyBase	N/A	ISS
GO:0034660	GO-bp	Annotation by Michelle Graham. GO Biological Process: ncRNA metabolic process	SoyBase	N/A	ISS
GO:0045893	GO-bp	Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0009535	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid membrane	SoyBase	N/A	ISS
GO:0003700	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity	SoyBase	N/A	ISS
PF00504	PFAM	Chlorophyll A-B binding protein	JGI		ISS
UniRef100_B9N2V9	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Light harvesting-like protein 3 n=1 Tax=Populus trichocarpa RepID=B9N2V9_POPTR	SoyBase	E_val: 6.00E-95	ISS
UniRef100_I1J9Q8	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1J9Q8_SOYBN	SoyBase	E_val: 7.00E-156	ISS

Expression Patterns of Glyma01g41320

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma01g41320 not represented in the dataset	Glyma01g41320 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma01g41320 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.01g204700	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma01g41320

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma01g41320

Limit To All Plant Sequences

>Glyma01g41320.1   sequence type=CDS   gene model=Glyma01g41320   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCCTCGTTTTCTCCTCTGACTAATTTCTCAACCGCACCTTCACCGTATTCCAAAATCGGTTTCTTCCACAACCCCTTCATCACTCTCAGATCCAGCAATGCTTTGCTTCGCCTCTCTCCCTTGAAGGTTTCAGCTGACAATGAGGTTGCAACCTCAGCTTCAGCTTTTGAGGAACCAAGATGGATTGGAGGGACTTGGGACTTAAAACAGTTTCAGATAAATGGCAACACTGACTGGGATGCTGTTATTGATGCTGAGGTTAAGAGAAGAAAATGGCTTGGGGACAATCCGGAATCATCTACTAATGATAACCCTGTAGTTTTTAACACCGCCATTATTCCTTGGTGGGCATGGATAAAAAGGTTCCATCTTCCTGAAGCTGAACTACTTAATGGTCGTGCTGCAATGATAGGATTTTTTATGGCCTATGTGGTTGATAGCTTGACTGGAGTAGGTGTAGTTGACCAAATGAGCAATTTCTTCTGCAAAACTCTTCTGTTCACAGCAGTGAGTGGAATACTTCTGGTCCGAAAGAATGAGGACATTGAAACTCTTAAGAAGCTATGGGAAGAGATTACATTTTATGACAAGCAATGGCAAGCAACTTGGCAGGATGAAAACTCAAGTACTCCCAAAAAAGATTAG

Predicted protein sequences of Glyma01g41320

Limit To All Plant Sequences

>Glyma01g41320.1   sequence type=predicted peptide   gene model=Glyma01g41320   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASFSPLTNFSTAPSPYSKIGFFHNPFITLRSSNALLRLSPLKVSADNEVATSASAFEEPRWIGGTWDLKQFQINGNTDWDAVIDAEVKRRKWLGDNPESSTNDNPVVFNTAIIPWWAWIKRFHLPEAELLNGRAAMIGFFMAYVVDSLTGVGVVDQMSNFFCKTLLFTAVSGILLVRKNEDIETLKKLWEEITFYDKQWQATWQDENSSTPKKD*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain