Glyma01g40630 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma01g40630

Feature Type:	gene_model
Chromosome:	Gm01
Start:	52329397
stop:	52330870
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma01g40630

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G16680	AT	Annotation by Michelle Graham. TAIR10: RING/FYVE/PHD zinc finger superfamily protein \| chr5:5467534-5472956 REVERSE LENGTH=1311	SoyBase	E_val: 3.00E-18	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0006486	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein glycosylation	SoyBase	N/A	ISS
GO:0009630	GO-bp	Annotation by Michelle Graham. GO Biological Process: gravitropism	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003677	GO-mf	Annotation by Michelle Graham. GO Molecular Function: DNA binding	SoyBase	N/A	ISS
GO:0008270	GO-mf	Annotation by Michelle Graham. GO Molecular Function: zinc ion binding	SoyBase	N/A	ISS
UniRef100_G7K541	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Bromodomain adjacent to zinc finger domain protein 2B n=1 Tax=Medicago truncatula RepID=G7K541_MEDTR	SoyBase	E_val: 2.00E-18	ISS
UniRef100_I1J9I8	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1J9I8_SOYBN	SoyBase	E_val: 6.00E-169	ISS

Expression Patterns of Glyma01g40630

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma01g40630

Paralog	Evidence	Comments
Glyma11g04671	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma01g40630 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma01g40630

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma01g40630

Limit To All Plant Sequences

>Glyma01g40630.1   sequence type=CDS   gene model=Glyma01g40630   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
GGCAAGTTTCAGATACACAACATTGAGGGTATTGCAAGGACTTGGGATGCGATTCAAGCTCACTTATCGAATCGTGCATCAGCCGAAGTTCTTGAAGTGGCGAATACGAATAGGCTTTCTGAGATTATTATACTGGAGGAACTACCTCGATTGAGGACTTGGCCATCTCAATTTATGAGAAGTCAAGTCACTGAAGATAATATTGCTCAGTACTTTTTTGCACATGACTCTGATAGCTATATATATTATGAACAATTGGTGAATTACATGATGAATAATGACTTGGCTCTGAAAGGACATTTGGATGGGGATGGAATGGCATGTTTTTCCTTTGGGGTGTATTCAGAGGACAAAAGGCGAATAACTCAGCAAGTACACCCAGTGTCAAATTCTCTCAAGCTAAAAAATGGAGATGACATGGCAATAGTTGATGAAATTCCTGAATTTGAATCTTCAGGAGACACAGTTTTGGCGGTTGGAGAGAATTCCGATAGTAAAGGAGGAGTGGCAAATGCAGAGCATGCAGTTGTAGATATTAATAATGTTTCACTTTGGCCTAAAAGTGAAACCCAAGAAAATGGTTCTGTTGGGATTGAGGAGTCTCTTGTACCACCTTCAACTCCAGATTCAGACCGGTTGCAAGCTGTGGCTGCTTTGTTTTTGCTCGCTGAGGGTCACATGGAGTTTTGA

Predicted protein sequences of Glyma01g40630

Limit To All Plant Sequences

>Glyma01g40630.1   sequence type=predicted peptide   gene model=Glyma01g40630   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
GKFQIHNIEGIARTWDAIQAHLSNRASAEVLEVANTNRLSEIIILEELPRLRTWPSQFMRSQVTEDNIAQYFFAHDSDSYIYYEQLVNYMMNNDLALKGHLDGDGMACFSFGVYSEDKRRITQQVHPVSNSLKLKNGDDMAIVDEIPEFESSGDTVLAVGENSDSKGGVANAEHAVVDINNVSLWPKSETQENGSVGIEESLVPPSTPDSDRLQAVAALFLLAEGHMEF*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain