SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma01g40580): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma01g40580): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma01g40580

Feature Type:gene_model
Chromosome:Gm01
Start:52271472
stop:52276739
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G22780AT Annotation by Michelle Graham. TAIR10: peroxisomal NAD-malate dehydrogenase 1 | chr2:9689995-9691923 REVERSE LENGTH=354 SoyBaseE_val: 3.00E-157ISS
GO:0005975GO-bp Annotation by Michelle Graham. GO Biological Process: carbohydrate metabolic process SoyBaseN/AISS
GO:0006108GO-bp Annotation by Michelle Graham. GO Biological Process: malate metabolic process SoyBaseN/AISS
GO:0006635GO-bp Annotation by Michelle Graham. GO Biological Process: fatty acid beta-oxidation SoyBaseN/AISS
GO:0007031GO-bp Annotation by Michelle Graham. GO Biological Process: peroxisome organization SoyBaseN/AISS
GO:0009062GO-bp Annotation by Michelle Graham. GO Biological Process: fatty acid catabolic process SoyBaseN/AISS
GO:0031998GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of fatty acid beta-oxidation SoyBaseN/AISS
GO:0044262GO-bp Annotation by Michelle Graham. GO Biological Process: cellular carbohydrate metabolic process SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0080093GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of photorespiration SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005777GO-cc Annotation by Michelle Graham. GO Cellular Compartment: peroxisome SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0003824GO-mf Annotation by Michelle Graham. GO Molecular Function: catalytic activity SoyBaseN/AISS
GO:0016491GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity SoyBaseN/AISS
GO:0016615GO-mf Annotation by Michelle Graham. GO Molecular Function: malate dehydrogenase activity SoyBaseN/AISS
GO:0016616GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor SoyBaseN/AISS
GO:0030060GO-mf Annotation by Michelle Graham. GO Molecular Function: L-malate dehydrogenase activity SoyBaseN/AISS
KOG1494 KOG NAD-dependent malate dehydrogenase JGI ISS
PTHR11540Panther MALATE AND LACTATE DEHYDROGENASE JGI ISS
PTHR11540:SF1Panther MALATE DEHYDROGENASE JGI ISS
PF00056PFAM lactate/malate dehydrogenase, NAD binding domain JGI ISS
PF02866PFAM lactate/malate dehydrogenase, alpha/beta C-terminal domain JGI ISS
UniRef100_I1J9I3UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=2 Tax=Glycine max RepID=I1J9I3_SOYBN SoyBaseE_val: 9.00E-180ISS
UniRef100_I1LH25UniRef Annotation by Michelle Graham. Most informative UniRef hit: Malate dehydrogenase n=1 Tax=Glycine max RepID=I1LH25_SOYBN SoyBaseE_val: 2.00E-177ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma01g40580 not represented in the dataset

Glyma01g40580 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma11g04720 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.01g197700 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma01g40580.2   sequence type=CDS   gene model=Glyma01g40580   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCGTTTTTCGGCCGGTGAAAGGCCTTTTTCGACTTACGCTTTGTTCACATTTTTCGTTAGGGGGTTTTTGGGGCAGCAGCAGCTTGAGGATGCACTTATAGGCATGGACTTGGTGATCATCCCTGCTGGTGTTCCCCGCAAACCTGGAATGACAAGAGACGATCTATTCAATATAAATGCTGGAATTGTTAAAACGTTGTGTGAAGCAATTGCAAAGTGCTGTCCTAAAGCCATTGTCAACTTCATAAGCAATCCAGTTAACTCCACGGTCCCAATTGAAGCCGAAGTTTTCAAAAGTGCTGGTACTTATGATCCCAAGAGACTTTTGGGAGTCACTATGCTTAGTGTTGTTAGAGCCAATACGTTTGTGGCAGAAGTTCTAGGTGTTGATCCAAGGGATGTGGATGTCCCAGTTGTTGGAGGACATGCTGGAATCACAATTTTACCTCTTCTTTCTCAGATTAAACCTCCTTGCTCTTTCACCCCAAAAGAAATTGAGTACCTGACTGATCGCATACAAAATGGTGGAACTGAAGTTGTTGAGGCCAAAGCTGGAGCTGGTTCTGCAACACTATCAATGGCATATGCTGCTGTTAAATTTGCAGATGCATGCCTTCATGCCCTGAGAGGAGATGCTGGCATCATTGAATGTGCATATGTTGCTTCACAGGTGGCTGAACTCCCGTTCTTTGCATCAAAAGTACGGCTTGGCCGAGGTGGGGTTGAGGAAATTCTTCCTCTTGGTCCCCTGAATGATTGTGAGAGGGAGAGTTTGGAAAAGGCCAAGAAAGAGTTAGCAGCAAGCATTGAGAAGGGTATTTCTTTCATCAGAAAATCAGTAGTTGATGACAGTTCGTCCCGAAAATAA

>Glyma01g40580.2   sequence type=predicted peptide   gene model=Glyma01g40580   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MRFSAGERPFSTYALFTFFVRGFLGQQQLEDALIGMDLVIIPAGVPRKPGMTRDDLFNINAGIVKTLCEAIAKCCPKAIVNFISNPVNSTVPIEAEVFKSAGTYDPKRLLGVTMLSVVRANTFVAEVLGVDPRDVDVPVVGGHAGITILPLLSQIKPPCSFTPKEIEYLTDRIQNGGTEVVEAKAGAGSATLSMAYAAVKFADACLHALRGDAGIIECAYVASQVAELPFFASKVRLGRGGVEEILPLGPLNDCERESLEKAKKELAASIEKGISFIRKSVVDDSSSRK*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo