SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma01g36810): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma01g36810): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma01g36810

Feature Type:gene_model
Chromosome:Gm01
Start:49235150
stop:49235590
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma01g36810
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G17770AT Annotation by Michelle Graham. TAIR10: basic region/leucine zipper motif 27 | chr2:7723103-7723573 FORWARD LENGTH=156 SoyBaseE_val: 3.00E-15ISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0009410GO-bp Annotation by Michelle Graham. GO Biological Process: response to xenobiotic stimulus SoyBaseN/AISS
GO:0009909GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of flower development SoyBaseN/AISS
GO:0010200GO-bp Annotation by Michelle Graham. GO Biological Process: response to chitin SoyBaseN/AISS
GO:0030968GO-bp Annotation by Michelle Graham. GO Biological Process: endoplasmic reticulum unfolded protein response SoyBaseN/AISS
GO:0048573GO-bp Annotation by Michelle Graham. GO Biological Process: photoperiodism, flowering SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
GO:0043565GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding SoyBaseN/AISS
GO:0046983GO-mf Annotation by Michelle Graham. GO Molecular Function: protein dimerization activity SoyBaseN/AISS
PF00170PFAM bZIP transcription factor JGI ISS
UniRef100_G7JXL9UniRef Annotation by Michelle Graham. Most informative UniRef hit: Basic leucine zipper transcription factor n=1 Tax=Medicago truncatula RepID=G7JXL9_MEDTR SoyBaseE_val: 5.00E-18ISS
UniRef100_I1J8I1UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1J8I1_SOYBN SoyBaseE_val: 2.00E-93ISS

Expression Patterns of Glyma01g36810
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma01g36810 not represented in the dataset
Glyma01g36810 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma01g36810 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.01g163500 Wm82.a2.v1IGC As supplied by JGI

References for Glyma01g36810
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma01g36810
>Glyma01g36810.1   sequence type=CDS   gene model=Glyma01g36810   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAAGAGGTGTGGAAAGACATTAACCTGGCTACCTTAAATGAGCAAAGCACCATTAGTACTCGCCCCAACGTCGAAGGCGTTATGTTTCAAGACTTTCTGGCTCGACCCTTCACCACCATTGACCCACCAAACACCACCTTACTTTCCTCTGCCTCTTCAGAAACCGCCGCTAATTCTCTTTTCTCCCCTGCCTCTCCTGGCCCACCTCTCGTCACTCTCAGCTTGAGCTCTCTCCCTCATCACCACCACTTCCGTTTCGAACACCCCTCCTCAATCCCTCCTCCACCCTCCAACAAAAGATTTGCTCAACCTGCTGACCATTGCAGCACCATAGGCGACAGAAGAAATAAGCGCATGATCAAGAATCGCGAGTCCGCTGCACGATCGCGTGCTAGAAAACAGGAATAG
Predicted protein sequences of Glyma01g36810
>Glyma01g36810.1   sequence type=predicted peptide   gene model=Glyma01g36810   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEEVWKDINLATLNEQSTISTRPNVEGVMFQDFLARPFTTIDPPNTTLLSSASSETAANSLFSPASPGPPLVTLSLSSLPHHHHFRFEHPSSIPPPPSNKRFAQPADHCSTIGDRRNKRMIKNRESAARSRARKQE*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo