Glyma01g36810 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma01g36810

Feature Type:	gene_model
Chromosome:	Gm01
Start:	49235150
stop:	49235590
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma01g36810

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G17770	AT	Annotation by Michelle Graham. TAIR10: basic region/leucine zipper motif 27 \| chr2:7723103-7723573 FORWARD LENGTH=156	SoyBase	E_val: 3.00E-15	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0009410	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to xenobiotic stimulus	SoyBase	N/A	ISS
GO:0009909	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of flower development	SoyBase	N/A	ISS
GO:0010200	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to chitin	SoyBase	N/A	ISS
GO:0030968	GO-bp	Annotation by Michelle Graham. GO Biological Process: endoplasmic reticulum unfolded protein response	SoyBase	N/A	ISS
GO:0048573	GO-bp	Annotation by Michelle Graham. GO Biological Process: photoperiodism, flowering	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003700	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity	SoyBase	N/A	ISS
GO:0043565	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding	SoyBase	N/A	ISS
GO:0046983	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein dimerization activity	SoyBase	N/A	ISS
PF00170	PFAM	bZIP transcription factor	JGI		ISS
UniRef100_G7JXL9	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Basic leucine zipper transcription factor n=1 Tax=Medicago truncatula RepID=G7JXL9_MEDTR	SoyBase	E_val: 5.00E-18	ISS
UniRef100_I1J8I1	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1J8I1_SOYBN	SoyBase	E_val: 2.00E-93	ISS

Expression Patterns of Glyma01g36810

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma01g36810 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.01g163500	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma01g36810

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma01g36810

Limit To All Plant Sequences

>Glyma01g36810.1   sequence type=CDS   gene model=Glyma01g36810   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAAGAGGTGTGGAAAGACATTAACCTGGCTACCTTAAATGAGCAAAGCACCATTAGTACTCGCCCCAACGTCGAAGGCGTTATGTTTCAAGACTTTCTGGCTCGACCCTTCACCACCATTGACCCACCAAACACCACCTTACTTTCCTCTGCCTCTTCAGAAACCGCCGCTAATTCTCTTTTCTCCCCTGCCTCTCCTGGCCCACCTCTCGTCACTCTCAGCTTGAGCTCTCTCCCTCATCACCACCACTTCCGTTTCGAACACCCCTCCTCAATCCCTCCTCCACCCTCCAACAAAAGATTTGCTCAACCTGCTGACCATTGCAGCACCATAGGCGACAGAAGAAATAAGCGCATGATCAAGAATCGCGAGTCCGCTGCACGATCGCGTGCTAGAAAACAGGAATAG

Predicted protein sequences of Glyma01g36810

Limit To All Plant Sequences

>Glyma01g36810.1   sequence type=predicted peptide   gene model=Glyma01g36810   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEEVWKDINLATLNEQSTISTRPNVEGVMFQDFLARPFTTIDPPNTTLLSSASSETAANSLFSPASPGPPLVTLSLSSLPHHHHFRFEHPSSIPPPPSNKRFAQPADHCSTIGDRRNKRMIKNRESAARSRARKQE*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain