Glyma01g36480 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma01g36480): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma01g36480): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma01g36480

Feature Type:	gene_model
Chromosome:	Gm01
Start:	48987939
stop:	48990441
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma01g36480

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G12500	AT	Annotation by Michelle Graham. TAIR10: basic chitinase \| chr3:3962501-3963984 REVERSE LENGTH=335	SoyBase	E_val: 6.00E-113	ISS
GO:0005975	GO-bp	Annotation by Michelle Graham. GO Biological Process: carbohydrate metabolic process	SoyBase	N/A	ISS
GO:0009871	GO-bp	Annotation by Michelle Graham. GO Biological Process: jasmonic acid and ethylene-dependent systemic resistance, ethylene mediated signaling pathway	SoyBase	N/A	ISS
GO:0010167	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to nitrate	SoyBase	N/A	ISS
GO:0015706	GO-bp	Annotation by Michelle Graham. GO Biological Process: nitrate transport	SoyBase	N/A	ISS
GO:0016998	GO-bp	Annotation by Michelle Graham. GO Biological Process: cell wall macromolecule catabolic process	SoyBase	N/A	ISS
GO:0046686	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to cadmium ion	SoyBase	N/A	ISS
GO:0050832	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response to fungus	SoyBase	N/A	ISS
GO:0005576	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: extracellular region	SoyBase	N/A	ISS
GO:0005773	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: vacuole	SoyBase	N/A	ISS
GO:0005774	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane	SoyBase	N/A	ISS
GO:0005829	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosol	SoyBase	N/A	ISS
GO:0004568	GO-mf	Annotation by Michelle Graham. GO Molecular Function: chitinase activity	SoyBase	N/A	ISS
GO:0008061	GO-mf	Annotation by Michelle Graham. GO Molecular Function: chitin binding	SoyBase	N/A	ISS
KOG4742	KOG	Predicted chitinase	JGI		ISS
PTHR22595	Panther	CHITINASE-RELATED	JGI		ISS
PTHR22595:SF11	Panther	CLASS I CHITINASE	JGI		ISS
PF00182	PFAM	Chitinase class I	JGI		ISS
UniRef100_I1J8E1	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1J8E1_SOYBN	SoyBase	E_val: 0	ISS
UniRef100_O81934	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Chitinase n=1 Tax=Canavalia ensiformis RepID=O81934_CANEN	SoyBase	E_val: 6.00E-148	ISS

Expression Patterns of Glyma01g36480

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma01g36480 not represented in the dataset	Glyma01g36480 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma01g36480 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.01g160100	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma01g36480

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma01g36480

Limit To All Plant Sequences

>Glyma01g36480.1   sequence type=CDS   gene model=Glyma01g36480   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAATTAGACACTATCTTCGCCTTTATCGTAGTTTATATTCTGCTGGTAACCTCATCAGAGTTCCCTAGTGTTGCTGCAGATGATGTTAGCAGCATCATCAGTGCTTCCCAATTTGAGCAATTGCTGAAACACAGAAACGATCAAATTTGTGAGGGGAAGAACGGATTCTACAGCTACAATGCTTTTGTCACTGCTGCCAGAACCTTTGATGGGTTTGGCACTACGGGTGATGTTAACACTCGTAAGAGGGAGGTTGCAGCTTTCCTAGCCCAAACCTCTCACGAGACCACAGGAGGAGGAGGATGGCCTAATGCCCCAGATGGGCCATATGCTTGGGGTTATTGCTTTGTCACAGAAAGAGATAAATCCAATAATTATTGTGAAATTAGCAAGGCACCATGTGCCTCAGGCAAATCATACTATGGTCGAGGACCCCTTCAGCTGACACACAACTACAACTATGATCTAGCTGGAAAAGCCATACATTCAGACTTGATAAACAATCCAGACTTGGTAGCCCAAGACCCAGTGGTATCATTCCAGACAGCTATATGGTTTTGGATGACATCACAAGCCAATAAGCCCTCATGCCACGACGTGATCACCAATAGGTGGACCCCATCTTCTGTCGACATGGCAGCTAATAGAGCCCCAGGTTATGGTGTGATCACCAACATCATCAACGGTAGGATTGAATGTGGGAATGGTCCTTCTCCAGCCTCAAATGACAGGATCGGGTTTTATAAAAAGTATTGTGAGATTTTTGGGCTCTCAGATGCTACCAACTTGGATTGCAGTAGCCAAAAGTCCTTTGATCAAGATTAA

Predicted protein sequences of Glyma01g36480

Limit To All Plant Sequences

>Glyma01g36480.1   sequence type=predicted peptide   gene model=Glyma01g36480   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKLDTIFAFIVVYILLVTSSEFPSVAADDVSSIISASQFEQLLKHRNDQICEGKNGFYSYNAFVTAARTFDGFGTTGDVNTRKREVAAFLAQTSHETTGGGGWPNAPDGPYAWGYCFVTERDKSNNYCEISKAPCASGKSYYGRGPLQLTHNYNYDLAGKAIHSDLINNPDLVAQDPVVSFQTAIWFWMTSQANKPSCHDVITNRWTPSSVDMAANRAPGYGVITNIINGRIECGNGPSPASNDRIGFYKKYCEIFGLSDATNLDCSSQKSFDQD*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain