SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma01g33326): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma01g33326): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma01g33326

Feature Type:gene_model
Chromosome:Gm01
Start:45317461
stop:45320741
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
ATMG01320AT Annotation by Michelle Graham. TAIR10: NADH dehydrogenase 2B | chrM:327890-333105 REVERSE LENGTH=499 SoyBaseE_val: 2.00E-58ISS
GO:0042773GO-bp Annotation by Michelle Graham. GO Biological Process: ATP synthesis coupled electron transport SoyBaseN/AISS
GO:0045333GO-bp Annotation by Michelle Graham. GO Biological Process: cellular respiration SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005747GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrial respiratory chain complex I SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0003954GO-mf Annotation by Michelle Graham. GO Molecular Function: NADH dehydrogenase activity SoyBaseN/AISS
GO:0008137GO-mf Annotation by Michelle Graham. GO Molecular Function: NADH dehydrogenase (ubiquinone) activity SoyBaseN/AISS
PTHR22773Panther NADH DEHYDROGENASE JGI ISS
PTHR22773:SF41Panther NADH DEHYDROGENASE SUBUNIT 2 JGI ISS
PF00361PFAM NADH-Ubiquinone/plastoquinone (complex I), various chains JGI ISS
UniRef100_E9KZK9UniRef Annotation by Michelle Graham. Best UniRef hit: NADH dehydrogenase subunit 2 n=1 Tax=Vigna radiata RepID=E9KZK9_VIGRA SoyBaseE_val: 1.00E-58ISS
UniRef100_E9KZK9UniRef Annotation by Michelle Graham. Most informative UniRef hit: NADH dehydrogenase subunit 2 n=1 Tax=Vigna radiata RepID=E9KZK9_VIGRA SoyBaseE_val: 1.00E-58ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma01g33326 not represented in the dataset

Glyma01g33326 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.01g136900 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma01g33326.1   sequence type=CDS   gene model=Glyma01g33326   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAAACAAAATTTGTTCGGATCCTTCCACATATAGAGCTAGCCTATTCATTATGGGGGAATCAATACTCCGAGCCAAATAAAGTAGAGCTTACCTCTGGCACCTGGCTTTATCCGGCACATATTAGCTTAGCTATGCTTAATAGGTTGGCTTCCTCTCTGGCGGCCACATTTTGCTTACCTTACCCATGCTACAATCCCATTCCAAGCTACACCTTGCCAGCTAAGCAAGATGCATTGCGATTTCTATTAGACAAGAGGGACAATTTTACATATTTCTGCCAAATCCTTCTATTATTAAGTACGGCTGGTACCATTTCGATGTGTTTCGATTCTTCCGAACAAGAGAGGTATGATGCTTTTGAATTCATTATATTAATTCCACTTCCTACTCGCAATATGCTCTTTATGATCTTGGCTCATGATTCAATTGCCATGTATTTAGCTATTGAGCCTCAAAGTTTATGTTTTTATGTGATGGTAGCATCAAAAAGAAAGTTTGAATTTTCCATGGAGGTCGGCTCAAAATATTTGATCTTAGGTGCATTTTCCTCTGGAATCTTACTGTTTGGGTACGACCGGACAACTACCGATATCTAA

>Glyma01g33326.1   sequence type=predicted peptide   gene model=Glyma01g33326   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKTKFVRILPHIELAYSLWGNQYSEPNKVELTSGTWLYPAHISLAMLNRLASSLAATFCLPYPCYNPIPSYTLPAKQDALRFLLDKRDNFTYFCQILLLLSTAGTISMCFDSSEQERYDAFEFIILIPLPTRNMLFMILAHDSIAMYLAIEPQSLCFYVMVASKRKFEFSMEVGSKYLILGAFSSGILLFGYDRTTTDI*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo