SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma01g29643): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma01g29643): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma01g29643

Feature Type:gene_model
Chromosome:Gm01
Start:39958766
stop:39959672
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G50660AT Annotation by Michelle Graham. TAIR10: Cytochrome P450 superfamily protein | chr3:18814262-18817168 REVERSE LENGTH=513 SoyBaseE_val: 7.00E-64ISS
GO:0009741GO-bp Annotation by Michelle Graham. GO Biological Process: response to brassinosteroid stimulus SoyBaseN/AISS
GO:0009753GO-bp Annotation by Michelle Graham. GO Biological Process: response to jasmonic acid stimulus SoyBaseN/AISS
GO:0009826GO-bp Annotation by Michelle Graham. GO Biological Process: unidimensional cell growth SoyBaseN/AISS
GO:0009867GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:0010358GO-bp Annotation by Michelle Graham. GO Biological Process: leaf shaping SoyBaseN/AISS
GO:0016126GO-bp Annotation by Michelle Graham. GO Biological Process: sterol biosynthetic process SoyBaseN/AISS
GO:0016132GO-bp Annotation by Michelle Graham. GO Biological Process: brassinosteroid biosynthetic process SoyBaseN/AISS
GO:0048366GO-bp Annotation by Michelle Graham. GO Biological Process: leaf development SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0005783GO-cc Annotation by Michelle Graham. GO Cellular Compartment: endoplasmic reticulum SoyBaseN/AISS
GO:0005506GO-mf Annotation by Michelle Graham. GO Molecular Function: iron ion binding SoyBaseN/AISS
GO:0009055GO-mf Annotation by Michelle Graham. GO Molecular Function: electron carrier activity SoyBaseN/AISS
GO:0010012GO-mf Annotation by Michelle Graham. GO Molecular Function: steroid 22-alpha hydroxylase activity SoyBaseN/AISS
GO:0016705GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen SoyBaseN/AISS
GO:0020037GO-mf Annotation by Michelle Graham. GO Molecular Function: heme binding SoyBaseN/AISS
PTHR24286Panther FAMILY NOT NAMED JGI ISS
PTHR24286:SF57Panther JGI ISS
UniRef100_G7LEU0UniRef Annotation by Michelle Graham. Most informative UniRef hit: Cytochrome P450 enzyme n=1 Tax=Medicago truncatula RepID=G7LEU0_MEDTR SoyBaseE_val: 6.00E-68ISS
UniRef100_I1JCQ8UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1JCQ8_SOYBN SoyBaseE_val: 1.00E-87ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma01g29643 not represented in the dataset

Glyma01g29643 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.01g120600 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma01g29643.1   sequence type=CDS   gene model=Glyma01g29643   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGGTGGCCCTTTCTTGGGGAAACCATAGGGTATTTGAACCTTTACCCTGCTGTTACACTTGGAGAATTTATGGAGAACCACATAGCAAGGTATGGTAAAATTTACAAGTCAAACTTGTTTGGGGGGCCAACCATAAACGATGGGAAGTTGTTTGAGATCAGCAATCCTAAGAGCATTTGTGATATACTCAGGAAATGGTCTATGTTGGTCTTAGTAGGGGACATGCACAAGGAAATGAGGAACATTTCACTCAACTTTCTCAGCAATGCTAAGCTCCAAACACATCTTGTCAAAGAGGTCGAGAGGCATGCACTTCTCATTATTAACTCATGGAACAATAATTCTACATTCTCCGCTCTACAAGAAGCCAAAAAGTTCACCTTCAATTTTATGGAGAAACGTATAATGAGCTTGGAGCCTGGGAATCCCGAAACAGGATAG

>Glyma01g29643.1   sequence type=predicted peptide   gene model=Glyma01g29643   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGWPFLGETIGYLNLYPAVTLGEFMENHIARYGKIYKSNLFGGPTINDGKLFEISNPKSICDILRKWSMLVLVGDMHKEMRNISLNFLSNAKLQTHLVKEVERHALLIINSWNNNSTFSALQEAKKFTFNFMEKRIMSLEPGNPETG*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo