|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT3G50660 | AT | Annotation by Michelle Graham. TAIR10: Cytochrome P450 superfamily protein | chr3:18814262-18817168 REVERSE LENGTH=513 | SoyBase | E_val: 7.00E-64 | ISS |
| GO:0009741 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to brassinosteroid stimulus | SoyBase | N/A | ISS |
| GO:0009753 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to jasmonic acid stimulus | SoyBase | N/A | ISS |
| GO:0009826 | GO-bp | Annotation by Michelle Graham. GO Biological Process: unidimensional cell growth | SoyBase | N/A | ISS |
| GO:0009867 | GO-bp | Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway | SoyBase | N/A | ISS |
| GO:0010358 | GO-bp | Annotation by Michelle Graham. GO Biological Process: leaf shaping | SoyBase | N/A | ISS |
| GO:0016126 | GO-bp | Annotation by Michelle Graham. GO Biological Process: sterol biosynthetic process | SoyBase | N/A | ISS |
| GO:0016132 | GO-bp | Annotation by Michelle Graham. GO Biological Process: brassinosteroid biosynthetic process | SoyBase | N/A | ISS |
| GO:0048366 | GO-bp | Annotation by Michelle Graham. GO Biological Process: leaf development | SoyBase | N/A | ISS |
| GO:0055114 | GO-bp | Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process | SoyBase | N/A | ISS |
| GO:0005783 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: endoplasmic reticulum | SoyBase | N/A | ISS |
| GO:0005506 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: iron ion binding | SoyBase | N/A | ISS |
| GO:0009055 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: electron carrier activity | SoyBase | N/A | ISS |
| GO:0010012 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: steroid 22-alpha hydroxylase activity | SoyBase | N/A | ISS |
| GO:0016705 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen | SoyBase | N/A | ISS |
| GO:0020037 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: heme binding | SoyBase | N/A | ISS |
| PTHR24286 | Panther | FAMILY NOT NAMED | JGI | ISS | |
| PTHR24286:SF57 | Panther | JGI | ISS | ||
| UniRef100_G7LEU0 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: Cytochrome P450 enzyme n=1 Tax=Medicago truncatula RepID=G7LEU0_MEDTR | SoyBase | E_val: 6.00E-68 | ISS |
| UniRef100_I1JCQ8 | UniRef | Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1JCQ8_SOYBN | SoyBase | E_val: 1.00E-87 | ISS |
|
Glyma01g29643 not represented in the dataset |
Glyma01g29643 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.01g120600 | Wm82.a2.v1 | IGC | As supplied by JGI |
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma01g29643.1 sequence type=CDS gene model=Glyma01g29643 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGGGGTGGCCCTTTCTTGGGGAAACCATAGGGTATTTGAACCTTTACCCTGCTGTTACACTTGGAGAATTTATGGAGAACCACATAGCAAGGTATGGTAAAATTTACAAGTCAAACTTGTTTGGGGGGCCAACCATAAACGATGGGAAGTTGTTTGAGATCAGCAATCCTAAGAGCATTTGTGATATACTCAGGAAATGGTCTATGTTGGTCTTAGTAGGGGACATGCACAAGGAAATGAGGAACATTTCACTCAACTTTCTCAGCAATGCTAAGCTCCAAACACATCTTGTCAAAGAGGTCGAGAGGCATGCACTTCTCATTATTAACTCATGGAACAATAATTCTACATTCTCCGCTCTACAAGAAGCCAAAAAGTTCACCTTCAATTTTATGGAGAAACGTATAATGAGCTTGGAGCCTGGGAATCCCGAAACAGGATAG
>Glyma01g29643.1 sequence type=predicted peptide gene model=Glyma01g29643 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MGWPFLGETIGYLNLYPAVTLGEFMENHIARYGKIYKSNLFGGPTINDGKLFEISNPKSICDILRKWSMLVLVGDMHKEMRNISLNFLSNAKLQTHLVKEVERHALLIINSWNNNSTFSALQEAKKFTFNFMEKRIMSLEPGNPETG*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||