Glyma01g28550 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma01g28550): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma01g28550): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma01g28550

Feature Type:	gene_model
Chromosome:	Gm01
Start:	38422859
stop:	38424428
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma01g28550

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G40060	AT	Annotation by Michelle Graham. TAIR10: Clathrin light chain protein \| chr2:16726564-16728001 FORWARD LENGTH=258	SoyBase	E_val: 8.00E-70	ISS
GO:0006886	GO-bp	Annotation by Michelle Graham. GO Biological Process: intracellular protein transport	SoyBase	N/A	ISS
GO:0016192	GO-bp	Annotation by Michelle Graham. GO Biological Process: vesicle-mediated transport	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0009504	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cell plate	SoyBase	N/A	ISS
GO:0009941	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope	SoyBase	N/A	ISS
GO:0030130	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: clathrin coat of trans-Golgi network vesicle	SoyBase	N/A	ISS
GO:0030132	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: clathrin coat of coated pit	SoyBase	N/A	ISS
GO:0005198	GO-mf	Annotation by Michelle Graham. GO Molecular Function: structural molecule activity	SoyBase	N/A	ISS
PTHR10639	Panther	CLATHRIN LIGHT CHAIN	JGI		ISS
PTHR10639:SF0	Panther	PROTEIN BINDING / PROTEIN TRANSPORTER/ STRUCTURAL	JGI		ISS
PF01086	PFAM	Clathrin light chain	JGI		ISS
UniRef100_I1J7A5	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1J7A5_SOYBN	SoyBase	E_val: 0	ISS
UniRef100_O04209	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Clathrin light chain 2 n=1 Tax=Arabidopsis thaliana RepID=CLC2_ARATH	SoyBase	E_val: 4.00E-67	ISS

Expression Patterns of Glyma01g28550

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma01g28550 not represented in the dataset	Glyma01g28550 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma01g28550 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.01g115100	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma01g28550

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma01g28550

Limit To All Plant Sequences

>Glyma01g28550.1   sequence type=CDS   gene model=Glyma01g28550   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGGCGCTTTGGCCGGCTACTCCCTCTCCAACTTCGACGCGGTCAAGGACTCCACCGGTGACTCCTCCCCGATTATCGGTGGCGCGCCGTACAATGCCGGTGGAGACTTCGTCTCCGCCTCCGATCTACTCCGTCGCCGCGTTCTCGCCGGAGCAGAATGGGAAGGGTGTGGATGGTGGTTTCGGTGCCTCAGATGGCCCGATCTTGCCGCCTCCGACGAATATGGTTGCGAAGGAAGGGTTTGCTTTGAGAGAATGGAGAATGCAAAACGCGATTCAATTGGAGGAAAAGGAGAAGAAGGAGAAGGAGATGCGGTCGCAGATCATAGAGGAAGCTGAAGAGTACAAAATTGAGTTCTACAGAAAGCGTGAGGTTAATGCTGAGAAAAACAAGGCTTCTAACAGGGAAAGAGAGAAGCTATTTTTGGCAAGCCGGGAGAAGTTCCATGCTGAAGCTGACAAAAATTACTGGAAGACAATCGGTGAACTCATTCCGCACGAAGTGCCTGCGATAGAGAAGAGAGGGAAAAAGGACAAAGTGAAGAAGCCTTCTATTGCTGTAATCCAGGGCCCAAAACCAGGGAAGCCAACTGATCTTTCAAGAATGCGCCATATATTATTGAAGCTCAAACATAATCTCCCTTCACATATGAAGCCCAAGCCTCCACCATCAGAAACCAAAAAGGATGCCAAAACTGGACCTCTTGATGGAGCTAGCACAAGTTCTAATCCTCCCAAGGTTGTGCTTGTGGCAATTCCTGAGGCTGTTGCTGCAGCTTGA

Predicted protein sequences of Glyma01g28550

Limit To All Plant Sequences

>Glyma01g28550.1   sequence type=predicted peptide   gene model=Glyma01g28550   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAALWPATPSPTSTRSRTPPVTPPRLSVARRTMPVETSSPPPIYSVAAFSPEQNGKGVDGGFGASDGPILPPPTNMVAKEGFALREWRMQNAIQLEEKEKKEKEMRSQIIEEAEEYKIEFYRKREVNAEKNKASNREREKLFLASREKFHAEADKNYWKTIGELIPHEVPAIEKRGKKDKVKKPSIAVIQGPKPGKPTDLSRMRHILLKLKHNLPSHMKPKPPPSETKKDAKTGPLDGASTSSNPPKVVLVAIPEAVAAA*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain