Glyma01g27970 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma01g27970): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma01g27970): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma01g27970

Feature Type:	gene_model
Chromosome:	Gm01
Start:	37457418
stop:	37460795
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma01g27970

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G45960	AT	Annotation by Michelle Graham. TAIR10: plasma membrane intrinsic protein 1B \| chr2:18910450-18911703 FORWARD LENGTH=286	SoyBase	E_val: 4.00E-175	ISS
GO:0006096	GO-bp	Annotation by Michelle Graham. GO Biological Process: glycolysis	SoyBase	N/A	ISS
GO:0006810	GO-bp	Annotation by Michelle Graham. GO Biological Process: transport	SoyBase	N/A	ISS
GO:0006833	GO-bp	Annotation by Michelle Graham. GO Biological Process: water transport	SoyBase	N/A	ISS
GO:0006972	GO-bp	Annotation by Michelle Graham. GO Biological Process: hyperosmotic response	SoyBase	N/A	ISS
GO:0007030	GO-bp	Annotation by Michelle Graham. GO Biological Process: Golgi organization	SoyBase	N/A	ISS
GO:0009266	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to temperature stimulus	SoyBase	N/A	ISS
GO:0009414	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to water deprivation	SoyBase	N/A	ISS
GO:0009651	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to salt stress	SoyBase	N/A	ISS
GO:0015670	GO-bp	Annotation by Michelle Graham. GO Biological Process: carbon dioxide transport	SoyBase	N/A	ISS
GO:0032880	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of protein localization	SoyBase	N/A	ISS
GO:0046686	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to cadmium ion	SoyBase	N/A	ISS
GO:0055085	GO-bp	Annotation by Michelle Graham. GO Biological Process: transmembrane transport	SoyBase	N/A	ISS
GO:0005773	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: vacuole	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0016020	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: membrane	SoyBase	N/A	ISS
GO:0016021	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane	SoyBase	N/A	ISS
GO:0046658	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: anchored to plasma membrane	SoyBase	N/A	ISS
GO:0005215	GO-mf	Annotation by Michelle Graham. GO Molecular Function: transporter activity	SoyBase	N/A	ISS
GO:0015250	GO-mf	Annotation by Michelle Graham. GO Molecular Function: water channel activity	SoyBase	N/A	ISS
KOG0223	KOG	Aquaporin (major intrinsic protein family)	JGI		ISS
PTHR19139	Panther	AQUAPORIN TRANSPORTER	JGI		ISS
PTHR19139:SF55	Panther	SUBFAMILY NOT NAMED	JGI		ISS
PF00230	PFAM	Major intrinsic protein	JGI		ISS
UniRef100_C5IX22	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Plasma intrinsic protein 1;3 n=1 Tax=Juglans regia RepID=C5IX22_9ROSI	SoyBase	E_val: 4.00E-178	ISS
UniRef100_I1JLQ7	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JLQ7_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma01g27970

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma01g27970 not represented in the dataset	Glyma01g27970 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma01g27970

Paralog	Evidence	Comments
Glyma03g14150	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma01g27970 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.01g113400	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma01g27970

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma01g27970

Limit To All Plant Sequences

>Glyma01g27970.2   sequence type=CDS   gene model=Glyma01g27970   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGGGCAAAGAAGAGGATGTGAGAGTTGGAGCCAACAGGTACGGAGAGAGGCAGCCAATAGGAACCGCTGCTCAGGCCAAAGACTACAGAGAGCCACCCTCTGCACCTCTCTTTGAGGCCGGGGAGTTGTCATCCTGGTCTTTCTATAGGGCTGGCATAGCAGAGTTTGTGGCCACTTTCTTGTTCCTCTACATCACGGTCCTCACTGTGATGGGTGTGGCCAAATCCAAGAGCAAGTGTTCTACCGTGGGCATCCAAGGCATTGCTTGGGCTTTTGGGGGAATGATATTTGCTCTTGTTTATTGCACTGCTGGCATCTCGGGGGGTCATATTAACCCAGCAGTGACGTTTGGGCTGTTCTTGGCACGCAAGCTCTCTATGACAAGGGCAATTTTTTATATAATCATGCAGTGCTTGGGAGCTATATGTGGTGCCGGTGTAGTTAAGGGGTTCGAGCCACACCTCTATGAGAGGCTTGGTGGTGGTGCCAACACAATCGCTAAAGGGTACACCAATATTGCTGGCCTTGGAGCAGAGATTGTTGGCACATTTGTGCTTGTTTACACTGTCTTCTCTGCCACTGATGCCAAAAGAAATGCTAGAGACTCCCACGTTCCGATTTTGGCACCACTGCCTATTGGTTTTGCTGTGTTTCTAGTGCACTTGGCTACAATTCCTGTTACAGGGACTGGTATCAACCCTGCTAGAAGTCTAGGTGCAGCCATTATCTTCAACAAAGACCAAGCTTGGGATGACCATTGGATTTTTTGGGTTGGGCCTTTCATTGGGGCGGCACTTGCAGCTTTATACCATGGGAGTTGCTACGTGCACCCAGCATTATTGCTGGGGCACCCAGCAAACAGTGAAGTGGCGAAACTGCCCTTCATCAATTCTTCTTCCGGAAGAAGATTTTTTCCGGAAACTTTCCGAAAAACCTCTTTCCGGAAATTTTCCGGAAGAAGAATTTGTGACTTCTGGAAGTAC

Predicted protein sequences of Glyma01g27970

Limit To All Plant Sequences

>Glyma01g27970.2   sequence type=predicted peptide   gene model=Glyma01g27970   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEGKEEDVRVGANRYGERQPIGTAAQAKDYREPPSAPLFEAGELSSWSFYRAGIAEFVATFLFLYITVLTVMGVAKSKSKCSTVGIQGIAWAFGGMIFALVYCTAGISGGHINPAVTFGLFLARKLSMTRAIFYIIMQCLGAICGAGVVKGFEPHLYERLGGGANTIAKGYTNIAGLGAEIVGTFVLVYTVFSATDAKRNARDSHVPILAPLPIGFAVFLVHLATIPVTGTGINPARSLGAAIIFNKDQAWDDHWIFWVGPFIGAALAALYHGSCYVHPALLLGHPANSEVAKLPFINSSSGRRFFPETFRKTSFRKFSGRRICDFWKY

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain