Report for Sequence Feature Glyma01g27110
Feature Type: gene_model
Chromosome: Gm01
Start: 36127734
stop: 36131641
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma01g27110
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT3G11320 AT
Annotation by Michelle Graham. TAIR10: Nucleotide-sugar transporter family protein | chr3:3547017-3548539 REVERSE LENGTH=308
SoyBase E_val: 5.00E-166 ISS
GO:0006863 GO-bp
Annotation by Michelle Graham. GO Biological Process: purine nucleobase transport
SoyBase N/A ISS
GO:0016132 GO-bp
Annotation by Michelle Graham. GO Biological Process: brassinosteroid biosynthetic process
SoyBase N/A ISS
GO:0005783 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: endoplasmic reticulum
SoyBase N/A ISS
GO:0005794 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus
SoyBase N/A ISS
GO:0005886 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane
SoyBase N/A ISS
GO:0016020 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: membrane
SoyBase N/A ISS
GO:0008514 GO-mf
Annotation by Michelle Graham. GO Molecular Function: organic anion transmembrane transporter activity
SoyBase N/A ISS
KOG1441
KOG
Glucose-6-phosphate/phosphate and phosphoenolpyruvate/phosphate antiporter
JGI ISS
PTHR11132 Panther
SOLUTE CARRIER FAMILY 35
JGI ISS
PF00892 PFAM
EamA-like transporter family
JGI ISS
PF03151 PFAM
Triose-phosphate Transporter family
JGI ISS
UniRef100_G7JR70 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Solute carrier family 35 member E4 n=1 Tax=Medicago truncatula RepID=G7JR70_MEDTR
SoyBase E_val: 0 ISS
UniRef100_I1JLT3 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JLT3_SOYBN
SoyBase E_val: 0 ISS
Expression Patterns of Glyma01g27110
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma01g27110
Paralog Evidence Comments
Glyma03g14790 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma01g27110 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.01g110300 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma01g27110
Coding sequences of Glyma01g27110
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma01g27110.1 sequence type=CDS gene model=Glyma01g27110 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGATGATGACGATGAACAATATTGTTATTATTCCGTGGTCAACCATTGGCGTTGTGATTGCGTGGTACAGTTCCAACATAGGGGTCCTCCTTCTGAACAAGTACTTGCTCAGCAACTACGGCTTCAGGTTCCCCGTTTTCCTCACCACGTGTCACATGATGGTGTGCTCGCTCTTCAGCTACGTTATTGTTTCCGTTACGGACGCAGTTCCGCTGCAGCGCGTGCGGTCCAGGAGCCAGTTCGGGAGGATCGTGGCGCTCGGTGTCGTTTTCTGCTTCTCCGTCGTCTGCGGGAACGTGTCGCTCAGGTACATTCCTGTGTCGTTTAACCAGGCCATCGGAGCCACCACGCCGTTCTTCACCGCCGTTTTCGCTTACGCCGTGAGCGCCAAGAGGGAGGCGTGGGTTACTTACGCCACGCTCTTGCCCGTTGTTGCGGGCGTCGTCGTAGCTAGTGGGGGTGAACCAAGTTTCCATCTGTTTGGATTTGTAATCTGTGTTTCATCGACAGCTGCCAGAGCATTTAAATCAGTCCTTCAAGATATTTTGTTGTCCTCAGAGGGAGAAAAGTTGAATTCTATGAACCTGCTGCTTTATATGGCTCCAATAGCAGTGATGGTATTACTTCCTGCAACATTGTTGATGGAGGGAAATGTGATTCAGATCACAATGGATCTTGCCAGAAAGGATATCAGAATTTTTTGGTATCTGCTTCTCAGTTCATCTCTTGCGTATTTTGTGAACCTGACCAATTTTTTGGTGACGAAACATACAAGTGCACTTACCCTTCAGGTTTTAGGAAATGCAAAGGGAGCAGTTGCTGTGGTGGTCTCAATTTTGATATTCAAAAACCCCATTTCAATGATAGGAATGCTTGGCTATGCACTCACTGTCATTGGAGTTATATTGTACAGTGAAACCAAAAAGAGGTATAGCAAAAATTAG
Predicted protein sequences of Glyma01g27110
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma01g27110.1 sequence type=predicted peptide gene model=Glyma01g27110 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MMMTMNNIVIIPWSTIGVVIAWYSSNIGVLLLNKYLLSNYGFRFPVFLTTCHMMVCSLFSYVIVSVTDAVPLQRVRSRSQFGRIVALGVVFCFSVVCGNVSLRYIPVSFNQAIGATTPFFTAVFAYAVSAKREAWVTYATLLPVVAGVVVASGGEPSFHLFGFVICVSSTAARAFKSVLQDILLSSEGEKLNSMNLLLYMAPIAVMVLLPATLLMEGNVIQITMDLARKDIRIFWYLLLSSSLAYFVNLTNFLVTKHTSALTLQVLGNAKGAVAVVVSILIFKNPISMIGMLGYALTVIGVILYSETKKRYSKN*