Glyma01g26990 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma01g26990): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma01g26990): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma01g26990

Feature Type:	gene_model
Chromosome:	Gm01
Start:	35968044
stop:	35972769
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma01g26990

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G54090	AT	Annotation by Michelle Graham. TAIR10: fructokinase-like 1 \| chr3:20028145-20029835 FORWARD LENGTH=471	SoyBase	E_val: 0	ISS
GO:0006364	GO-bp	Annotation by Michelle Graham. GO Biological Process: rRNA processing	SoyBase	N/A	ISS
GO:0006399	GO-bp	Annotation by Michelle Graham. GO Biological Process: tRNA metabolic process	SoyBase	N/A	ISS
GO:0009658	GO-bp	Annotation by Michelle Graham. GO Biological Process: chloroplast organization	SoyBase	N/A	ISS
GO:0009793	GO-bp	Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy	SoyBase	N/A	ISS
GO:0010027	GO-bp	Annotation by Michelle Graham. GO Biological Process: thylakoid membrane organization	SoyBase	N/A	ISS
GO:0010228	GO-bp	Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem	SoyBase	N/A	ISS
GO:0016226	GO-bp	Annotation by Michelle Graham. GO Biological Process: iron-sulfur cluster assembly	SoyBase	N/A	ISS
GO:0042793	GO-bp	Annotation by Michelle Graham. GO Biological Process: transcription from plastid promoter	SoyBase	N/A	ISS
GO:0045893	GO-bp	Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0048481	GO-bp	Annotation by Michelle Graham. GO Biological Process: ovule development	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0009295	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleoid	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0042644	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast nucleoid	SoyBase	N/A	ISS
GO:0016301	GO-mf	Annotation by Michelle Graham. GO Molecular Function: kinase activity	SoyBase	N/A	ISS
GO:0016773	GO-mf	Annotation by Michelle Graham. GO Molecular Function: phosphotransferase activity, alcohol group as acceptor	SoyBase	N/A	ISS
KOG2855	KOG	Ribokinase	JGI		ISS
PTHR10584	Panther	SUGAR KINASE RELATED	JGI		ISS
PTHR10584:SF34	Panther	RIBOKINASE-RELATED	JGI		ISS
PF00294	PFAM	pfkB family carbohydrate kinase	JGI		ISS
UniRef100_D9IWP6	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Fructokinase-like protein 1 n=1 Tax=Vigna unguiculata RepID=D9IWP6_VIGUN	SoyBase	E_val: 0	ISS
UniRef100_I1J756	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1J756_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma01g26990

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma01g26990 not represented in the dataset	Glyma01g26990 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma01g26990

Paralog	Evidence	Comments
Glyma03g14960	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma01g26990 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.01g109700	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma01g26990

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma01g26990

Limit To All Plant Sequences

>Glyma01g26990.1   sequence type=CDS   gene model=Glyma01g26990   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGTCACTTCACCACCACCACCTTCTTCTTCCTCCCTTCCCCCACCTCCAATCCAAAACCTTCCACTCTCCACCCCCACCCAAAAGCCCCTCCTTCCACCGCAAAATCGCTCTCAGAGCCTCCACCGTTGAATCCCCAACCCCAAAACGACGCGGCCGCAAGAAGAAACCCGAAACACAAACACCACCCTCAAACGACACTCCTCCCCCCCAAGACGCAGACCCGAAAAAAGAAGAAGACGAAGTGTACGACTACGACGACGGCGTGGACTTCCCCTACTCGGACCCTCCCTTGATATGCTGCTTCGGCGCGGCACGGAGGGAGTTCATCCCGGCGGTGCGGGTGCAGGACTACCCGATGCACCCGGACATCTACTCCGAGTGGAAGATGCTGCAGTGGAAGCCCCCCGAGTTCGCACGCGCGCCGGGTGGCCCGCCGTCCAACGTGGCGGTGGCACACACTCGTCTCGGGGGGCGGGCGGCCTTCCTGGGGAAGGTCGGGGACGACGATTTCGGAGAAGAGATGGTGCTGATGATGAACGAGGAGAGGGTGCAGACGAGAGGAGTGAGGATTGATCCCGGGCGCAGGACGGGGTGCGCGTACATGAAGGTTAGGTTTGAGGAGGGGAGGATGAAGATGGAGACGGTTAGGGAGGCCGCAGAGGATTCGCTTCTTGCAACTGAACTCAACCTTGCCGTTTTGAAAGAGGCTAGGATTTTCCATTTCAATTCAGAAATTCTAACATGCCCCTCAATGGAATCAACATTATTCAGGGCAATTAAGTGGACTAAGAAGTTTGGTGGCCTTGTATTTTTTGATTTAAATCTGCCATTACCTCTTTGGAGATCACGTGATGAGACAAGAGAAATAATAAAAAAAGCATGGAATGAAGCAGACATCATTGAAGTTTCAAGAAGTGAGTTAGAATTCCTTCTAGATGAAGAATATTACGAGAGGAATAGAAATTATAGGCCACAATACTTTGCTGAAAGTTATGAACAAACCAAGAATCGACAGGAGTATTACCATTACACTGCTGAAGAAGTCTCGCCTTTGTGGCATGATCGACTTAAATTCCTGTTTGTGACTGATGGAACACTTAGAATTCACTACTATACCCCTTCTTTCGACGGGTCTGTGGTGGGAACTGAAGATGTGCTCATAACACCATATACTTGTGATAGAACTGGCTCAGGTGATGCTGTTGTGGCTGCCATTTTAAGAAAACTAACCACTTGCCCTGAAATGTTTGAAAATCAAGATGTTTTGGAGAGACAGCTACGCTTTGCTGTTGCAGCAGGAATTATATCCCAATGGACTATTGGTGCAGTTAGAGGTTTCCCTACCGAAAGTGCTACTCAGAATCTCAAAGAACAAGTTTATGTGCCTTCATTGTGGTGA

Predicted protein sequences of Glyma01g26990

Limit To All Plant Sequences

>Glyma01g26990.1   sequence type=predicted peptide   gene model=Glyma01g26990   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASLHHHHLLLPPFPHLQSKTFHSPPPPKSPSFHRKIALRASTVESPTPKRRGRKKKPETQTPPSNDTPPPQDADPKKEEDEVYDYDDGVDFPYSDPPLICCFGAARREFIPAVRVQDYPMHPDIYSEWKMLQWKPPEFARAPGGPPSNVAVAHTRLGGRAAFLGKVGDDDFGEEMVLMMNEERVQTRGVRIDPGRRTGCAYMKVRFEEGRMKMETVREAAEDSLLATELNLAVLKEARIFHFNSEILTCPSMESTLFRAIKWTKKFGGLVFFDLNLPLPLWRSRDETREIIKKAWNEADIIEVSRSELEFLLDEEYYERNRNYRPQYFAESYEQTKNRQEYYHYTAEEVSPLWHDRLKFLFVTDGTLRIHYYTPSFDGSVVGTEDVLITPYTCDRTGSGDAVVAAILRKLTTCPEMFENQDVLERQLRFAVAAGIISQWTIGAVRGFPTESATQNLKEQVYVPSLW*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain