Glyma01g26800 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma01g26800): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma01g26800): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma01g26800

Feature Type:	gene_model
Chromosome:	Gm01
Start:	35606473
stop:	35610217
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma01g26800

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G09220	AT	Annotation by Michelle Graham. TAIR10: laccase 7 \| chr3:2827434-2830477 REVERSE LENGTH=567	SoyBase	E_val: 7.00E-85	ISS
GO:0000041	GO-bp	Annotation by Michelle Graham. GO Biological Process: transition metal ion transport	SoyBase	N/A	ISS
GO:0006826	GO-bp	Annotation by Michelle Graham. GO Biological Process: iron ion transport	SoyBase	N/A	ISS
GO:0010106	GO-bp	Annotation by Michelle Graham. GO Biological Process: cellular response to iron ion starvation	SoyBase	N/A	ISS
GO:0010167	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to nitrate	SoyBase	N/A	ISS
GO:0015706	GO-bp	Annotation by Michelle Graham. GO Biological Process: nitrate transport	SoyBase	N/A	ISS
GO:0046274	GO-bp	Annotation by Michelle Graham. GO Biological Process: lignin catabolic process	SoyBase	N/A	ISS
GO:0055114	GO-bp	Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process	SoyBase	N/A	ISS
GO:0005576	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: extracellular region	SoyBase	N/A	ISS
GO:0048046	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: apoplast	SoyBase	N/A	ISS
GO:0005507	GO-mf	Annotation by Michelle Graham. GO Molecular Function: copper ion binding	SoyBase	N/A	ISS
GO:0016491	GO-mf	Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity	SoyBase	N/A	ISS
GO:0052716	GO-mf	Annotation by Michelle Graham. GO Molecular Function: hydroquinone:oxygen oxidoreductase activity	SoyBase	N/A	ISS
PTHR11709	Panther	MULTI-COPPER OXIDASE	JGI		ISS
PTHR11709:SF9	Panther	LACCASE	JGI		ISS
PF00394	PFAM	Multicopper oxidase	JGI		ISS
PF07732	PFAM	Multicopper oxidase	JGI		ISS
UniRef100_B9HC76	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Laccase 110a n=1 Tax=Populus trichocarpa RepID=B9HC76_POPTR	SoyBase	E_val: 1.00E-86	ISS
UniRef100_UPI0002337AE8	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI0002337AE8 related cluster n=1 Tax=unknown RepID=UPI0002337AE8	SoyBase	E_val: 6.00E-132	ISS

Expression Patterns of Glyma01g26800

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma01g26800 not represented in the dataset	Glyma01g26800 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma01g26800 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma01g26800

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma01g26800

Limit To All Plant Sequences

>Glyma01g26800.1   sequence type=CDS   gene model=Glyma01g26800   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
TCTTCGTTGGCTCATGCTGCGGTTGTGGAACACACTTTCAATGTGGAGGACATTTCTGTGCAACGTTTGTGTCGTCAACAACCGATCACTGCCGTTAATGGAACCCTGCAAGGACCAACAATTAACGCTCGAGAGGGTGATACTATTGTCGTTTACGTATTCAACAAGTCACCCTATAATCTTACTCTTCATTGGCACGGAATTATTCAATTTTTAACACCGTGGTCAGACGGTCCTGAATTTGTAACTCAATGCCCAATACCTTCTGGTGGCAGTTACACATATAAATTTAACCTAACAGGACAAGAAGGGACACTTTGGTGGCATGCACACTCGTCTTTTCTGCGTGCTACGGTCTATGGTGCTCTTTTAATTCGGCCTCGACTTGGACACTCCTACCCTTTTCCTAAAGTTTATCAAGAAGTCCCCATAATTATTGGAGAGTGGTGGAATGCTAATGTTGTAGAGGTTGAGCACAATGCAACAGAATCCCAAACGGCGCCAATCCCCTCAGCTGCGTATACAATTAACGGTTTACCCGGCTATTTCTGCAACTGCTCTGAAAGTCGTCGTTTTCGAAGCATATTTGGTCTCCGGTGGTGTACGAGCATTGTTCAAGAGTATACGGTGAAGTTGGGTCGCTTTTCGTCGCTAGAGAATAAGAGGTATGCAAAAAAAATTTAG

Predicted protein sequences of Glyma01g26800

Limit To All Plant Sequences

>Glyma01g26800.1   sequence type=predicted peptide   gene model=Glyma01g26800   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
SSLAHAAVVEHTFNVEDISVQRLCRQQPITAVNGTLQGPTINAREGDTIVVYVFNKSPYNLTLHWHGIIQFLTPWSDGPEFVTQCPIPSGGSYTYKFNLTGQEGTLWWHAHSSFLRATVYGALLIRPRLGHSYPFPKVYQEVPIIIGEWWNANVVEVEHNATESQTAPIPSAAYTINGLPGYFCNCSESRRFRSIFGLRWCTSIVQEYTVKLGRFSSLENKRYAKKI*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain