SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma01g26300): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma01g26300): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma01g26300

Feature Type:gene_model
Chromosome:Gm01
Start:34545483
stop:34547230
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma01g26300
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G53990AT Annotation by Michelle Graham. TAIR10: Adenine nucleotide alpha hydrolases-like superfamily protein | chr3:19989658-19991019 REVERSE LENGTH=160 SoyBaseE_val: 8.00E-89ISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
PF00582PFAM Universal stress protein family JGI ISS
UniRef100_I1J728UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1J728_SOYBN SoyBaseE_val: 6.00E-115ISS
UniRef100_Q9M328UniRef Annotation by Michelle Graham. Most informative UniRef hit: AT3G53990 protein n=1 Tax=Arabidopsis thaliana RepID=Q9M328_ARATH SoyBaseE_val: 4.00E-86ISS

Expression Patterns of Glyma01g26300
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma01g26300 not represented in the dataset
Glyma01g26300 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma01g26300
ParalogEvidenceComments
Glyma03g16510 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma01g26300 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.01g106200 Wm82.a2.v1IGC As supplied by JGI

References for Glyma01g26300
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma01g26300
>Glyma01g26300.1   sequence type=CDS   gene model=Glyma01g26300   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCAAAGGATAGAACAATTGGTGTGGCTCTAGATTTCTCCAAAAGCAGCAAGAATGCTCTGAAATGGGCATTTGAGAACTTAGCCGATAAAGGTGACACCATTTATGTCATTCACATCAACCCAAACTCTCTAGACGAGTCCCGCAACAAGCTATGGGCAAAATCTGGTTCTCCTCTTATTCCTTTGGTAGAGTTCAGAGAGCCTGAGATTATGAAAAAGTATGATGTTGAAATTGATATTGAGGTTCTTGATATGCTTGACACTGCTTCAAGACAAAAAGAGATCCACATTGTTACAAAAATATATTGGGGGGATGCAAGAGAGAAGCTTTTGGATGCTATTGAAGATCTGAAGCTGGATTCGCTGGTTATGGGAAGCAGGGGCCTCAGCACAATCCAAAGGATCATATTGGGAAGTGTAAGCAACTTTGTGATGACAAATGCTCCTTGCCCTGTGACTATCGTCAAGGAACCACCTAGCAGCAGCAAGTAA
Predicted protein sequences of Glyma01g26300
>Glyma01g26300.1   sequence type=predicted peptide   gene model=Glyma01g26300   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAKDRTIGVALDFSKSSKNALKWAFENLADKGDTIYVIHINPNSLDESRNKLWAKSGSPLIPLVEFREPEIMKKYDVEIDIEVLDMLDTASRQKEIHIVTKIYWGDAREKLLDAIEDLKLDSLVMGSRGLSTIQRIILGSVSNFVMTNAPCPVTIVKEPPSSSK*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo