SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma01g24543

Feature Type:gene_model
Chromosome:Gm01
Start:32028705
stop:32031074
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma01g24543
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G02110AT Annotation by Michelle Graham. TAIR10: CYCLIN D7;1 | chr5:417087-418553 FORWARD LENGTH=341 SoyBaseE_val: 1.00E-24ISS
GO:0009790GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development SoyBaseN/AISS
GO:0051726GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cell cycle SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0004693GO-mf Annotation by Michelle Graham. GO Molecular Function: cyclin-dependent protein kinase activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
KOG0656 KOG G1/S-specific cyclin D JGI ISS
PTHR10177Panther CYCLINS JGI ISS
PTHR10177:SF76Panther CYCLIN-D JGI ISS
PF00134PFAM Cyclin, N-terminal domain JGI ISS
UniRef100_A8Y924UniRef Annotation by Michelle Graham. Most informative UniRef hit: D7-type cyclin n=1 Tax=Populus trichocarpa RepID=A8Y924_POPTR SoyBaseE_val: 5.00E-53ISS
UniRef100_UPI00023379DBUniRef Annotation by Michelle Graham. Best UniRef hit: UPI00023379DB related cluster n=1 Tax=unknown RepID=UPI00023379DB SoyBaseE_val: 5.00E-143ISS

Expression Patterns of Glyma01g24543
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma01g24543 not represented in the dataset
Glyma01g24543 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma01g24543
ParalogEvidenceComments
Glyma03g12220 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma01g24543 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.01g100000 Wm82.a2.v1IGC As supplied by JGI

References for Glyma01g24543
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma01g24543
>Glyma01g24543.1   sequence type=CDS   gene model=Glyma01g24543   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGATAATTTGCTATGTGATGAGGTGTGGCTTTCAAAGTCTGCAAATACTTTTGAAGAAGTTATTAGTGACCCTGTTGCACTAAAGAGTTATGAAAATGAAGAGTTTGAAGAGGCTTTTGCAGTGTGTCTAGAGAAGGAGGTCTTGTGCTTGCCCGAACCTGACTATACAAAGTACTTACACTCCAACAATTTGATTTTTCCTAGGTGTAGAGTTATTCAATGGTTTATCAAGTGTAGAAGACGCTTTAATCTTTCTTTTGGGACAGTTTTCTTGGCTTTTAATTATCTTGATCGCTTTGTATCCATTTGTCAATGCAATGTGGAGGGCTTGGACTATTCATTCCAATCAAACGTAATTTTGAAAATGGAGCTGATCCTATTGAAGGCGTTGGGGTGGCGCCTTAACTCTATGACAAGTTTTTCTTTTGCAGAAATGCTAGGTTTTGATTTCTTGGAACCTCATCATCATGTGAAGCTTATTTCACGAGTCACTGATCTCCTTGTCCAAGCTACTTTAGATCAGAAAATGATGGAATTCAGGCCAAGTGTTGTTGGTATGTCTGCATTGTGGTGCACTCTAGACCAGTTATTTCCACCAACATCAGACACTTACATTGCTTATATTATGAGTATCTTAAACCAAAGCCAGAAGTCAGAAAATAGGTACGAAAGTGCAGTAGGATATTATGTTGGAGGAGAGTGGGAGCAGTCAAATTAA
Predicted protein sequences of Glyma01g24543
>Glyma01g24543.1   sequence type=predicted peptide   gene model=Glyma01g24543   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MDNLLCDEVWLSKSANTFEEVISDPVALKSYENEEFEEAFAVCLEKEVLCLPEPDYTKYLHSNNLIFPRCRVIQWFIKCRRRFNLSFGTVFLAFNYLDRFVSICQCNVEGLDYSFQSNVILKMELILLKALGWRLNSMTSFSFAEMLGFDFLEPHHHVKLISRVTDLLVQATLDQKMMEFRPSVVGMSALWCTLDQLFPPTSDTYIAYIMSILNQSQKSENRYESAVGYYVGGEWEQSN*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo