SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma01g23230): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma01g23230): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma01g23230

Feature Type:gene_model
Chromosome:Gm01
Start:29843907
stop:29847664
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G24140AT Annotation by Michelle Graham. TAIR10: basic helix-loop-helix (bHLH) DNA-binding superfamily protein | chr3:8715525-8717772 REVERSE LENGTH=414 SoyBaseE_val: 6.00E-146ISS
GO:0000165GO-bp Annotation by Michelle Graham. GO Biological Process: MAPK cascade SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0006612GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane SoyBaseN/AISS
GO:0009617GO-bp Annotation by Michelle Graham. GO Biological Process: response to bacterium SoyBaseN/AISS
GO:0009862GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009867GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:0009965GO-bp Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis SoyBaseN/AISS
GO:0010052GO-bp Annotation by Michelle Graham. GO Biological Process: guard cell differentiation SoyBaseN/AISS
GO:0010103GO-bp Annotation by Michelle Graham. GO Biological Process: stomatal complex morphogenesis SoyBaseN/AISS
GO:0010310GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process SoyBaseN/AISS
GO:0010363GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response SoyBaseN/AISS
GO:0030154GO-bp Annotation by Michelle Graham. GO Biological Process: cell differentiation SoyBaseN/AISS
GO:0031348GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response SoyBaseN/AISS
GO:0035304GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of protein dephosphorylation SoyBaseN/AISS
GO:0045597GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of cell differentiation SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0051782GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of cell division SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
PTHR11534Panther MYOGENIC FACTOR JGI ISS
PTHR11534:SF7Panther MYOGENIC FACTOR MYF-5 JGI ISS
PF00010PFAM Helix-loop-helix DNA-binding domain JGI ISS
UniRef100_B9RWI9UniRef Annotation by Michelle Graham. Most informative UniRef hit: DNA binding protein, putative n=1 Tax=Ricinus communis RepID=B9RWI9_RICCO SoyBaseE_val: 9.00E-154ISS
UniRef100_UPI00023379CAUniRef Annotation by Michelle Graham. Best UniRef hit: UPI00023379CA related cluster n=1 Tax=unknown RepID=UPI00023379CA SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma01g23230 not represented in the dataset

Glyma01g23230 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.01g093400 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma01g23230.1   sequence type=CDS   gene model=Glyma01g23230   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGAAAGATCACAACTATTCGGCACCACCACCATCCATGCCTCCAATCTTCAACACATTAGACTACTCTCTAGACCAACATCATTTGTATGCACCAAATCAACACCAACAACACCTGATGAAGTTCCAAGGTTCCGGTGATGAAAACAACAATGGATCAATGGTGGATTACATGCCTCAAACAACACCCCCACATGGCTTTTATGGTGCTACTAGTGCCGCCACAACATCCTATGACAAACTGAGTTTTGCAGATGTGATGCAGTTTGCAGATTTTGGACCAAAGTTAGCTTTGAACCAAGCAAAAAACTGTGAAGAGTCTGCAATAGACCCGGTTTATTTTCTCAAGTTTCCCGTGTTAAACAACAAGATGGAGGAGGATCAGCAGAATATGATGATGAATAATGATGACCCTGATGGTGATGAAGCAGAAAATCATCATCATGATGAGAGGTTCAACAACTTGGTGAGTGTGGAAGACAAAGAGGGAATGATGGTGAGAGAGGATGAAGAGACTACACGGGTTTCCGACGACAACAACTCGGTGCAGATTCGGTTTCTTGGGCATGAAGAGCCTCAGCAGAAGAATAATTGTGCAGTGCAGGAGAACAAGAACGGCAAGAGGAAGAGGCCAAGAACTGTTAAGACAAGTGAGGAGGTTGAGAGCCAGCGCATGACTCACATAGCGGTTGAAAGGAACCGTAGGAAGCAAATGAATGAGCATCTTCGTGTCCTTAGATCCCTCATGCCTGGTTCATACGTCCAAAGGGGTGATCAAGCTTCCATAATTGGGGGGGCTATAGAGTTTGTGAGGGAATTGGAGCAACTTCTTCAGTGTTTGGAGTCACAAAAGAGGAGGAGGCTACTTGGAGAAGCTCAAGCAAGACAAGTTGGGGATCCATCTCTTGCAACACAACAACAGCCTCCATTCTTTCCACCTTTGCCTATTCCAAATGAGCAGATGAAGCTTGTGGAGATGGAGACCGGACTCCACGAAGAAACCGCGGAGAGCAAGTCTTGTTTGGCTGATGTTGAAGTGAAGCTTCTAGGATTTGATGCCATGATCAAAATCCTATCAAGGAGGAGGCCAGGACAGCTGATCAAGACCATTGCTGCTCTTGAAGATCTTCAGCTTATCATCCTTCACACCAACATCACCACCATTGAACAAACAGTTCTATATTCATTCAATGTCAAGGTGGCTAGTGATTCAAGGTTCACCGCAGAAGATATAGCCAGCTCCGTCCAGCAGATATTCAATTTTATTCATGCAAACACTAGCATGTGA

>Glyma01g23230.1   sequence type=predicted peptide   gene model=Glyma01g23230   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEKDHNYSAPPPSMPPIFNTLDYSLDQHHLYAPNQHQQHLMKFQGSGDENNNGSMVDYMPQTTPPHGFYGATSAATTSYDKLSFADVMQFADFGPKLALNQAKNCEESAIDPVYFLKFPVLNNKMEEDQQNMMMNNDDPDGDEAENHHHDERFNNLVSVEDKEGMMVREDEETTRVSDDNNSVQIRFLGHEEPQQKNNCAVQENKNGKRKRPRTVKTSEEVESQRMTHIAVERNRRKQMNEHLRVLRSLMPGSYVQRGDQASIIGGAIEFVRELEQLLQCLESQKRRRLLGEAQARQVGDPSLATQQQPPFFPPLPIPNEQMKLVEMETGLHEETAESKSCLADVEVKLLGFDAMIKILSRRRPGQLIKTIAALEDLQLIILHTNITTIEQTVLYSFNVKVASDSRFTAEDIASSVQQIFNFIHANTSM*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo