SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma01g17330): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma01g17330): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma01g17330

Feature Type:gene_model
Chromosome:Gm01
Start:21487779
stop:21490647
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G31500AT Annotation by Michelle Graham. TAIR10: cytochrome P450, family 83, subfamily B, polypeptide 1 | chr4:15273677-15275271 REVERSE LENGTH=499 SoyBaseE_val: 8.00E-156ISS
GO:0000096GO-bp Annotation by Michelle Graham. GO Biological Process: sulfur amino acid metabolic process SoyBaseN/AISS
GO:0000162GO-bp Annotation by Michelle Graham. GO Biological Process: tryptophan biosynthetic process SoyBaseN/AISS
GO:0006520GO-bp Annotation by Michelle Graham. GO Biological Process: cellular amino acid metabolic process SoyBaseN/AISS
GO:0006546GO-bp Annotation by Michelle Graham. GO Biological Process: glycine catabolic process SoyBaseN/AISS
GO:0006569GO-bp Annotation by Michelle Graham. GO Biological Process: tryptophan catabolic process SoyBaseN/AISS
GO:0006636GO-bp Annotation by Michelle Graham. GO Biological Process: unsaturated fatty acid biosynthetic process SoyBaseN/AISS
GO:0006733GO-bp Annotation by Michelle Graham. GO Biological Process: oxidoreduction coenzyme metabolic process SoyBaseN/AISS
GO:0006766GO-bp Annotation by Michelle Graham. GO Biological Process: vitamin metabolic process SoyBaseN/AISS
GO:0008652GO-bp Annotation by Michelle Graham. GO Biological Process: cellular amino acid biosynthetic process SoyBaseN/AISS
GO:0009072GO-bp Annotation by Michelle Graham. GO Biological Process: aromatic amino acid family metabolic process SoyBaseN/AISS
GO:0009106GO-bp Annotation by Michelle Graham. GO Biological Process: lipoate metabolic process SoyBaseN/AISS
GO:0009108GO-bp Annotation by Michelle Graham. GO Biological Process: coenzyme biosynthetic process SoyBaseN/AISS
GO:0009117GO-bp Annotation by Michelle Graham. GO Biological Process: nucleotide metabolic process SoyBaseN/AISS
GO:0009641GO-bp Annotation by Michelle Graham. GO Biological Process: shade avoidance SoyBaseN/AISS
GO:0009682GO-bp Annotation by Michelle Graham. GO Biological Process: induced systemic resistance SoyBaseN/AISS
GO:0009684GO-bp Annotation by Michelle Graham. GO Biological Process: indoleacetic acid biosynthetic process SoyBaseN/AISS
GO:0009695GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid biosynthetic process SoyBaseN/AISS
GO:0009759GO-bp Annotation by Michelle Graham. GO Biological Process: indole glucosinolate biosynthetic process SoyBaseN/AISS
GO:0010114GO-bp Annotation by Michelle Graham. GO Biological Process: response to red light SoyBaseN/AISS
GO:0019288GO-bp Annotation by Michelle Graham. GO Biological Process: isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway SoyBaseN/AISS
GO:0019748GO-bp Annotation by Michelle Graham. GO Biological Process: secondary metabolic process SoyBaseN/AISS
GO:0019761GO-bp Annotation by Michelle Graham. GO Biological Process: glucosinolate biosynthetic process SoyBaseN/AISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0044272GO-bp Annotation by Michelle Graham. GO Biological Process: sulfur compound biosynthetic process SoyBaseN/AISS
GO:0048830GO-bp Annotation by Michelle Graham. GO Biological Process: adventitious root development SoyBaseN/AISS
GO:0052544GO-bp Annotation by Michelle Graham. GO Biological Process: defense response by callose deposition in cell wall SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005783GO-cc Annotation by Michelle Graham. GO Cellular Compartment: endoplasmic reticulum SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0005506GO-mf Annotation by Michelle Graham. GO Molecular Function: iron ion binding SoyBaseN/AISS
GO:0009055GO-mf Annotation by Michelle Graham. GO Molecular Function: electron carrier activity SoyBaseN/AISS
GO:0016705GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen SoyBaseN/AISS
GO:0016709GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen SoyBaseN/AISS
GO:0019825GO-mf Annotation by Michelle Graham. GO Molecular Function: oxygen binding SoyBaseN/AISS
GO:0020037GO-mf Annotation by Michelle Graham. GO Molecular Function: heme binding SoyBaseN/AISS
KOG0156 KOG Cytochrome P450 CYP2 subfamily JGI ISS
PTHR24298Panther FAMILY NOT NAMED JGI ISS
PTHR24298:SF44Panther JGI ISS
PF00067PFAM Cytochrome P450 JGI ISS
UniRef100_G7JZM8UniRef Annotation by Michelle Graham. Most informative UniRef hit: Cytochrome P450 71B35 n=1 Tax=Medicago truncatula RepID=G7JZM8_MEDTR SoyBaseE_val: 0ISS
UniRef100_I1J6H2UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1J6H2_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma01g17330 not represented in the dataset

Glyma01g17330 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.01g078300 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma01g17330.1   sequence type=CDS   gene model=Glyma01g17330   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGACCAAAATATGTTACCATTATTTGTTCTTTTAGCTTTTCCCATTTTGCTATTATTCTTCAGAAAACGCAAAACATCTAAGAAGCCAACCTTTCCACCAGGCCCTAGAGGCCTTCCCTTTATTGGCAATCTTTATCAACTCGATGGTTCTACTCTTTGTTTGAAACTCTATGAACTCTCAAAAAAATATGGTCCCATCTTTTCCCTTCAACTAGGTTCAAGGCCAGCCCTCGTTGTTTCCTCACCAAAACTGGCCAAGGAGGTAATGAAAACCCATGACCTTGAGTTCTGTGGGCGACCCTCCCTCATAAGCACAATGAAGTTTTCATATAATGGGCTAGACATGGCATTTTCACCCTATAGAGATTATTGGAGACACACTAGAAAAATTTCCATCATCCATTTCCTTAGCCTCAAGCGTGTCTTAATGTTTTCCTCAATAAGAAAATACGAGGTTACCCAATTGGTCAAAAAGATAACGGAACATGCTTCTTGTTCCAAGGTTACCAACTTGCATGAGTTGCTCACGTGTCTTACGAGCGCTGTAGTGTGTAGAACTGCTTTGGGTAGAAGGTACGAAGAGGAAGGGATCGAGAGAAGCATGTTCCATGGCTTGCTTAAAGAAGCTCAAGAATTGACAGCTTCCACCTTCTACACAGATTATATTCCTCTTGTTGGAGGAGTGGTTGATAAACTCACTGGGTTGATGGGTCGTCTTGAGAAAATGTTCAAGGTGTTGGATGGGTTTTATCAGAATGCTATTGATGAACACCTTGATCCTGAAAGGAAGAAACTCACTGATGAACAGGATATAATCGATGCCTTGCTTCAATTGAAGAATGATCGTTCGTTCTCAATGGATCTCACTCCCGCTCACATCAAACCCTTGATGATGAATATAATTTTGGCAGGGACAGATACAAGTGCAGCTGCAGTAGTTTGGGCAATGACGGCACTAATGAAGAGCCCGATAGTAATGAAGAAAGCCCAAGAAGAGATTAGAAACATTTTTGGCGGGAAAGATTTTATAGAGGAAGATGATATTCAAAAGCTTCCTTATGTTCAGGCAGTTATAAAAGAAACAATGAGAATCTACCCACCATTGCCCTTGCTTTTACAAAGGGAAACGATTAAAAAGTGTAGCATTGCAGGGTACGAAATTCCAGAGAAGACATTGGTGTATGTGAATGCTTGGGCAGTGCATAGAGACCCAGAAACTTGGGAGGAGCCAGAAGAGTTTTATCCTGAGAGATTCCTAGACAGCAAAATTGATTTTAGGGGTTATGATTTCGAGTTGATTCCATTTGGCGCAGGCCGAAGGATTTGCCCGGGCATAAATATGGGAATTATCACAGTGGAACTTGTGCTTGCTAATCTTCTGTATTCATTTGATTGGGAAATGCCTCAAGGGATGAAAAGGGAAGACATAGACACTGATATGCTTCCAGGACTTATCCAACACAAGAAAAATCCTCTCTGCCTAGTTGCTAAGAAGCAAGGGTGA

>Glyma01g17330.1   sequence type=predicted peptide   gene model=Glyma01g17330   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MDQNMLPLFVLLAFPILLLFFRKRKTSKKPTFPPGPRGLPFIGNLYQLDGSTLCLKLYELSKKYGPIFSLQLGSRPALVVSSPKLAKEVMKTHDLEFCGRPSLISTMKFSYNGLDMAFSPYRDYWRHTRKISIIHFLSLKRVLMFSSIRKYEVTQLVKKITEHASCSKVTNLHELLTCLTSAVVCRTALGRRYEEEGIERSMFHGLLKEAQELTASTFYTDYIPLVGGVVDKLTGLMGRLEKMFKVLDGFYQNAIDEHLDPERKKLTDEQDIIDALLQLKNDRSFSMDLTPAHIKPLMMNIILAGTDTSAAAVVWAMTALMKSPIVMKKAQEEIRNIFGGKDFIEEDDIQKLPYVQAVIKETMRIYPPLPLLLQRETIKKCSIAGYEIPEKTLVYVNAWAVHRDPETWEEPEEFYPERFLDSKIDFRGYDFELIPFGAGRRICPGINMGIITVELVLANLLYSFDWEMPQGMKREDIDTDMLPGLIQHKKNPLCLVAKKQG*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo