SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma01g14700): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma01g14700): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma01g14700

Feature Type:gene_model
Chromosome:Gm01
Start:18300893
stop:18301399
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G45030AT Annotation by Michelle Graham. TAIR10: Translation elongation factor EFG/EF2 protein | chr2:18572411-18576756 FORWARD LENGTH=754 SoyBaseE_val: 3.00E-63ISS
GO:0006414GO-bp Annotation by Michelle Graham. GO Biological Process: translational elongation SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0005622GO-cc Annotation by Michelle Graham. GO Cellular Compartment: intracellular SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0003746GO-mf Annotation by Michelle Graham. GO Molecular Function: translation elongation factor activity SoyBaseN/AISS
GO:0003924GO-mf Annotation by Michelle Graham. GO Molecular Function: GTPase activity SoyBaseN/AISS
GO:0005525GO-mf Annotation by Michelle Graham. GO Molecular Function: GTP binding SoyBaseN/AISS
GO:0008135GO-mf Annotation by Michelle Graham. GO Molecular Function: translation factor activity, nucleic acid binding SoyBaseN/AISS
PTHR23115Panther TRANSLATION FACTOR JGI ISS
PTHR23115:SF13Panther TRANSLATION ELONGATION FACTOR G JGI ISS
PF00009PFAM Elongation factor Tu GTP binding domain JGI ISS
UniRef100_F4IW10UniRef Annotation by Michelle Graham. Most informative UniRef hit: Elongation factor EF-G n=2 Tax=Arabidopsis thaliana RepID=F4IW10_ARATH SoyBaseE_val: 2.00E-60ISS
UniRef100_I1J6E8UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=4 Tax=Glycine max RepID=I1J6E8_SOYBN SoyBaseE_val: 2.00E-80ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma01g14700 not represented in the dataset

Glyma01g14700 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.01g075100 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma01g14700.2   sequence type=CDS   gene model=Glyma01g14700   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
GAAATTTTTTTAACACTCGGAATCCGATCCACGTCCCCAGTTGGAACCCATTTCCGTAGTCAAAACCCCAGAGAACGTAGCCACAAGGGCAAAACCCTTCCCCCCGCCATGGCACGCGTATCCCGGTCCTCCCCCCCGCGCCTCCTCTACTCCCTCTGCTGCACCACTGCATCGCGGTCACCGGCGTCGTCCCTCATCGGCGGCGCCTTCCATCTCCGCCACTTTTCAGCCGGGAACGCGGCGCGCACGAAGCCGGACAAGGAGCCGTGGTGGAAGGAGTCAATGGAGCGGCTCCGCAACATCGGAATCTCGGCGCACATCGACTCCGGGAAGACAACTCTGACGGAGCGGGTTCTGTACTACACTGGTCGGATCCACGAAATCCACGAGGTCAGGGGCAGGGACGGCGTCGGCGCCAAGATGGACTCCATGGACTTGGAGAGGGAGAAGGGAATCACCATTCAGTCTGCTGCCACCTACTGCACTTGGAAAGATTATAAGGTTTGA

>Glyma01g14700.2   sequence type=predicted peptide   gene model=Glyma01g14700   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
EIFLTLGIRSTSPVGTHFRSQNPRERSHKGKTLPPAMARVSRSSPPRLLYSLCCTTASRSPASSLIGGAFHLRHFSAGNAARTKPDKEPWWKESMERLRNIGISAHIDSGKTTLTERVLYYTGRIHEIHEVRGRDGVGAKMDSMDLEREKGITIQSAATYCTWKDYKV*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo