Glyma01g12970 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma01g12970

Feature Type:	gene_model
Chromosome:	Gm01
Start:	16134797
stop:	16136261
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma01g12970

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G17870	AT	Annotation by Michelle Graham. TAIR10: Polyketide cyclase/dehydrase and lipid transport superfamily protein \| chr4:9928792-9929367 FORWARD LENGTH=191	SoyBase	E_val: 9.00E-87	ISS
GO:0009738	GO-bp	Annotation by Michelle Graham. GO Biological Process: abscisic acid mediated signaling pathway	SoyBase	N/A	ISS
GO:0010029	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of seed germination	SoyBase	N/A	ISS
GO:0080163	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of protein serine/threonine phosphatase activity	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
GO:0010427	GO-mf	Annotation by Michelle Graham. GO Molecular Function: abscisic acid binding	SoyBase	N/A	ISS
GO:0042803	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein homodimerization activity	SoyBase	N/A	ISS
PF10604	PFAM	Polyketide cyclase / dehydrase and lipid transport	JGI		ISS
UniRef100_C6TKF4	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6TKF4_SOYBN	SoyBase	E_val: 2.00E-156	ISS
UniRef100_F2YHU9	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Abscisic acid receptor PYR1 n=1 Tax=Fragaria x ananassa RepID=F2YHU9_FRAAN	SoyBase	E_val: 8.00E-100	ISS

Expression Patterns of Glyma01g12970

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma01g12970 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.01g097000	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma01g12970

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma01g12970

Limit To All Plant Sequences

>Glyma01g12970.1   sequence type=CDS   gene model=Glyma01g12970   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAAAAAACGCACAGCTCCAGCGCAGAGGAGCAGGATCCGACCCGGCGCCACCTGGATCCCCCACCCGGGTTAACTGCTGAAGAGTTCGAGGACCTCAAACCCTCCGTGCTGGAGCACCACACCTACTCCGTCACACCCACCCGCCAAAGCTCCTCCCTCCTCGCGCAGCGCATCCACGCGCCACCACACGCGGTGTGGTCCGTCGTGCGCTGCTTCGACAACCCACAGGCCTACAAGCACTTCATCAAGAGCTGCCACGTCAAGGAGGGCTTCCAGCTCGCCGTGGGGTCCACCCGCGATGTCCACGTCATCTCAGGGCTACCGGCTGCCACCAGCACCGAGCGCCTCGACCTGCTCGACGACGACAGACACGTCATCGGCTTCACCATCGTCGGGGGCGACCACAGGCTCAGGAACTACCGGTCAGTCACCTCGGTGCACGGGTTCGAGTGCGACGGAAAGATCTGGACCGTTGTTCTGGAATCGTACGTCGTGGACGTGCCCGAAGGGAACACCGAGGAGGACACGCGTCTGTTTGCTGATACTGTTGTGAAGCTGAATCTGCAGAAGCTGGCGTCTGTCAGCGAAGGAATGTGCGGTGACGGTGACGGTGACGGTGACGGTAAGGGTAATAAATCATAG

Predicted protein sequences of Glyma01g12970

Limit To All Plant Sequences

>Glyma01g12970.1   sequence type=predicted peptide   gene model=Glyma01g12970   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEKTHSSSAEEQDPTRRHLDPPPGLTAEEFEDLKPSVLEHHTYSVTPTRQSSSLLAQRIHAPPHAVWSVVRCFDNPQAYKHFIKSCHVKEGFQLAVGSTRDVHVISGLPAATSTERLDLLDDDRHVIGFTIVGGDHRLRNYRSVTSVHGFECDGKIWTVVLESYVVDVPEGNTEEDTRLFADTVVKLNLQKLASVSEGMCGDGDGDGDGKGNKS*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain