SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma01g12970

Feature Type:gene_model
Chromosome:Gm01
Start:16134797
stop:16136261
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G17870AT Annotation by Michelle Graham. TAIR10: Polyketide cyclase/dehydrase and lipid transport superfamily protein | chr4:9928792-9929367 FORWARD LENGTH=191 SoyBaseE_val: 9.00E-87ISS
GO:0009738GO-bp Annotation by Michelle Graham. GO Biological Process: abscisic acid mediated signaling pathway SoyBaseN/AISS
GO:0010029GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of seed germination SoyBaseN/AISS
GO:0080163GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of protein serine/threonine phosphatase activity SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0010427GO-mf Annotation by Michelle Graham. GO Molecular Function: abscisic acid binding SoyBaseN/AISS
GO:0042803GO-mf Annotation by Michelle Graham. GO Molecular Function: protein homodimerization activity SoyBaseN/AISS
PF10604PFAM Polyketide cyclase / dehydrase and lipid transport JGI ISS
UniRef100_C6TKF4UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6TKF4_SOYBN SoyBaseE_val: 2.00E-156ISS
UniRef100_F2YHU9UniRef Annotation by Michelle Graham. Most informative UniRef hit: Abscisic acid receptor PYR1 n=1 Tax=Fragaria x ananassa RepID=F2YHU9_FRAAN SoyBaseE_val: 8.00E-100ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.01g097000 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma01g12970.1   sequence type=CDS   gene model=Glyma01g12970   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAAAAAACGCACAGCTCCAGCGCAGAGGAGCAGGATCCGACCCGGCGCCACCTGGATCCCCCACCCGGGTTAACTGCTGAAGAGTTCGAGGACCTCAAACCCTCCGTGCTGGAGCACCACACCTACTCCGTCACACCCACCCGCCAAAGCTCCTCCCTCCTCGCGCAGCGCATCCACGCGCCACCACACGCGGTGTGGTCCGTCGTGCGCTGCTTCGACAACCCACAGGCCTACAAGCACTTCATCAAGAGCTGCCACGTCAAGGAGGGCTTCCAGCTCGCCGTGGGGTCCACCCGCGATGTCCACGTCATCTCAGGGCTACCGGCTGCCACCAGCACCGAGCGCCTCGACCTGCTCGACGACGACAGACACGTCATCGGCTTCACCATCGTCGGGGGCGACCACAGGCTCAGGAACTACCGGTCAGTCACCTCGGTGCACGGGTTCGAGTGCGACGGAAAGATCTGGACCGTTGTTCTGGAATCGTACGTCGTGGACGTGCCCGAAGGGAACACCGAGGAGGACACGCGTCTGTTTGCTGATACTGTTGTGAAGCTGAATCTGCAGAAGCTGGCGTCTGTCAGCGAAGGAATGTGCGGTGACGGTGACGGTGACGGTGACGGTAAGGGTAATAAATCATAG

>Glyma01g12970.1   sequence type=predicted peptide   gene model=Glyma01g12970   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEKTHSSSAEEQDPTRRHLDPPPGLTAEEFEDLKPSVLEHHTYSVTPTRQSSSLLAQRIHAPPHAVWSVVRCFDNPQAYKHFIKSCHVKEGFQLAVGSTRDVHVISGLPAATSTERLDLLDDDRHVIGFTIVGGDHRLRNYRSVTSVHGFECDGKIWTVVLESYVVDVPEGNTEEDTRLFADTVVKLNLQKLASVSEGMCGDGDGDGDGKGNKS*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo