Glyma01g10206 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma01g10206): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma01g10206): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma01g10206

Feature Type:	gene_model
Chromosome:	Gm01
Start:	13259516
stop:	13263715
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma01g10206

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G02560	AT	Annotation by Michelle Graham. TAIR10: cullin-associated and neddylation dissociated \| chr2:690345-697342 FORWARD LENGTH=1217	SoyBase	E_val: 2.00E-141	ISS
GO:0003002	GO-bp	Annotation by Michelle Graham. GO Biological Process: regionalization	SoyBase	N/A	ISS
GO:0007155	GO-bp	Annotation by Michelle Graham. GO Biological Process: cell adhesion	SoyBase	N/A	ISS
GO:0009640	GO-bp	Annotation by Michelle Graham. GO Biological Process: photomorphogenesis	SoyBase	N/A	ISS
GO:0009733	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus	SoyBase	N/A	ISS
GO:0009790	GO-bp	Annotation by Michelle Graham. GO Biological Process: embryo development	SoyBase	N/A	ISS
GO:0009793	GO-bp	Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy	SoyBase	N/A	ISS
GO:0009845	GO-bp	Annotation by Michelle Graham. GO Biological Process: seed germination	SoyBase	N/A	ISS
GO:0009909	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of flower development	SoyBase	N/A	ISS
GO:0009933	GO-bp	Annotation by Michelle Graham. GO Biological Process: meristem structural organization	SoyBase	N/A	ISS
GO:0010051	GO-bp	Annotation by Michelle Graham. GO Biological Process: xylem and phloem pattern formation	SoyBase	N/A	ISS
GO:0010090	GO-bp	Annotation by Michelle Graham. GO Biological Process: trichome morphogenesis	SoyBase	N/A	ISS
GO:0010162	GO-bp	Annotation by Michelle Graham. GO Biological Process: seed dormancy process	SoyBase	N/A	ISS
GO:0010182	GO-bp	Annotation by Michelle Graham. GO Biological Process: sugar mediated signaling pathway	SoyBase	N/A	ISS
GO:0010228	GO-bp	Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem	SoyBase	N/A	ISS
GO:0016567	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein ubiquitination	SoyBase	N/A	ISS
GO:0019915	GO-bp	Annotation by Michelle Graham. GO Biological Process: lipid storage	SoyBase	N/A	ISS
GO:0022402	GO-bp	Annotation by Michelle Graham. GO Biological Process: cell cycle process	SoyBase	N/A	ISS
GO:0033043	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of organelle organization	SoyBase	N/A	ISS
GO:0045010	GO-bp	Annotation by Michelle Graham. GO Biological Process: actin nucleation	SoyBase	N/A	ISS
GO:0048316	GO-bp	Annotation by Michelle Graham. GO Biological Process: seed development	SoyBase	N/A	ISS
GO:0048449	GO-bp	Annotation by Michelle Graham. GO Biological Process: floral organ formation	SoyBase	N/A	ISS
GO:0048765	GO-bp	Annotation by Michelle Graham. GO Biological Process: root hair cell differentiation	SoyBase	N/A	ISS
GO:0050826	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to freezing	SoyBase	N/A	ISS
GO:0071555	GO-bp	Annotation by Michelle Graham. GO Biological Process: cell wall organization	SoyBase	N/A	ISS
GO:0005618	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cell wall	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0005829	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosol	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
PTHR12696	Panther	TIP120	JGI		ISS
UniRef100_B9SPA7	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Tip120, putative n=1 Tax=Ricinus communis RepID=B9SPA7_RICCO	SoyBase	E_val: 5.00E-149	ISS
UniRef100_UPI0002339210	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI0002339210 related cluster n=1 Tax=unknown RepID=UPI0002339210	SoyBase	E_val: 9.00E-173	ISS

Expression Patterns of Glyma01g10206

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma01g10206 not represented in the dataset	Glyma01g10206 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma01g10206 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.01g072200	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma01g10206

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma01g10206

Limit To All Plant Sequences

>Glyma01g10206.1   sequence type=CDS   gene model=Glyma01g10206   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGATAGCTCTTGCCCTGGAACTCTGTTGCACATTAATGGGTGACAAGAGGTCAAATCAAAGTATTGGTTTGGCCGTTAGAAACAAAGTTCTTCCCCAAGCTTTAACATTAATTAAAAGCTCATTGTTGCAGGGGCAAGCACTTTCGGCTTTGCAAAACGTTTTTGCTGCTTTAGTCTATTCTGCAAATACTAGTATTGATTATGTGTTGGAGTCATTATTTGCCTCTGCTAAGCCTTCTCCACAGTCTGGTGGCATTGCTAAACAAGCTTTGCATTCGATAGCTCAGTGTGTTACTATTCTATGCCTTGTTGCTGGTGATCAGAAGTGTTCATCTACAGTGAAAATGCTCACTGACATTCTCAAGGATGACAACAGTTCTAACTCCGTAAGCTTTTCTCTTCAAAGGAAGGATCTAAGTACATATGCACACATAGAAAATATTGTTATTGAATCTTTCCAGACCCCTTTTGAAGAGATAAAGTCTGCTGCCTCATATGCTCTTGGTAACATTGTTGTTGGTAATCTTCCAAAATACTTGCCATTTATCTTGGATCAAATTGATAATCAGCAGAAGAAACAATATCTCTTGCCTCATTCTTTGAAAGAGGTAATTGTGAGACAATCTGTAGATAAAGCAAAGTTTCAAGAGTCCAGTGTGGAGAAAATACTTAATTTACTCTTCAACCATTGTGAAAGTGAGGAAGAGAGAGTGTGCAATGTAATGCCTGTTAAACTCATCCCTGCACTCAAGGTAAGAACAACCAGCCCATCTGCATTTACTCGAGCTACTGTTGTCATTGCTGTGAAGTACTCCATAGATAACAATAGGGTTGTTATTATGAGTATGCAACATGTTAGGCGAGCTGCTGTTTTGGCTATAAGCACATTAGCACACAATAAGCCGAATCTCATTAAGGGGCTTCTTCCTGATCTGTTGCCTCTTCTATATGATCAAACTATTGTTAAGGTAACCTGA

Predicted protein sequences of Glyma01g10206

Limit To All Plant Sequences

>Glyma01g10206.1   sequence type=predicted peptide   gene model=Glyma01g10206   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MIALALELCCTLMGDKRSNQSIGLAVRNKVLPQALTLIKSSLLQGQALSALQNVFAALVYSANTSIDYVLESLFASAKPSPQSGGIAKQALHSIAQCVTILCLVAGDQKCSSTVKMLTDILKDDNSSNSVSFSLQRKDLSTYAHIENIVIESFQTPFEEIKSAASYALGNIVVGNLPKYLPFILDQIDNQQKKQYLLPHSLKEVIVRQSVDKAKFQESSVEKILNLLFNHCESEEERVCNVMPVKLIPALKVRTTSPSAFTRATVVIAVKYSIDNNRVVIMSMQHVRRAAVLAISTLAHNKPNLIKGLLPDLLPLLYDQTIVKVT*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain