Glyma01g09976 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma01g09976): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma01g09976): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma01g09976

Feature Type:	gene_model
Chromosome:	Gm01
Start:	12599051
stop:	12599537
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma01g09976

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G40540	AT	Annotation by Michelle Graham. TAIR10: potassium transporter 2 \| chr2:16931445-16934516 FORWARD LENGTH=794	SoyBase	E_val: 1.00E-51	ISS
GO:0000394	GO-bp	Annotation by Michelle Graham. GO Biological Process: RNA splicing, via endonucleolytic cleavage and ligation	SoyBase	N/A	ISS
GO:0006813	GO-bp	Annotation by Michelle Graham. GO Biological Process: potassium ion transport	SoyBase	N/A	ISS
GO:0009086	GO-bp	Annotation by Michelle Graham. GO Biological Process: methionine biosynthetic process	SoyBase	N/A	ISS
GO:0010075	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of meristem growth	SoyBase	N/A	ISS
GO:0071805	GO-bp	Annotation by Michelle Graham. GO Biological Process: potassium ion transmembrane transport	SoyBase	N/A	ISS
GO:0005739	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0016020	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: membrane	SoyBase	N/A	ISS
GO:0015079	GO-mf	Annotation by Michelle Graham. GO Molecular Function: potassium ion transmembrane transporter activity	SoyBase	N/A	ISS
PF02705	PFAM	K+ potassium transporter	JGI		ISS
UniRef100_Q06XL8	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: KUP2 n=1 Tax=Vitis vinifera RepID=Q06XL8_VITVI	SoyBase	E_val: 2.00E-60	ISS
UniRef100_UPI0002337705	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI0002337705 related cluster n=1 Tax=unknown RepID=UPI0002337705	SoyBase	E_val: 1.00E-107	ISS

Expression Patterns of Glyma01g09976

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma01g09976 not represented in the dataset	Glyma01g09976 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma01g09976 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.01g070900	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma01g09976

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma01g09976

Limit To All Plant Sequences

>Glyma01g09976.1   sequence type=CDS   gene model=Glyma01g09976   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAGCATTGAGGATGATGGTTCAAACTCCAATGAATCATCAAGTTATAGATTAACTGTAATTGGAACAACTGGTTTCACCATCCAACTAGGATACGAGAGTGGCAGGGAGAGTGTGCAGCAAGCATGTGTATCTGTTGGTTTCCCAATTGTACAAAGTGTTACTGATGTTATTGAGATGGAACTGGTCATGACTGAGAGGAGAGTGAGGTTTTCTATTGAAGATGAGCCTGAGAGTGATGCAAGGTCTGAGATAAGAGTGCAAATGCAGGAAGAGTTGGAAGATCTTTATGCTGCTCAAGAAGCTGGGATTGCCTTCATTCTAGGGCATTCTCATGTAAGAGCAAAGCAAGGCTCATCTGTACTAAAAAAGTTGGCACTTAACTTTGGCTACAATTTCTTGAGAAGGAATTGTAGAGGCCCTGATGTTGCACTTAAGGTTCCCCCAGTTTCTCTTTTGGAAGTTGGCATGGTTTATATTGTGTAG

Predicted protein sequences of Glyma01g09976

Limit To All Plant Sequences

>Glyma01g09976.1   sequence type=predicted peptide   gene model=Glyma01g09976   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSIEDDGSNSNESSSYRLTVIGTTGFTIQLGYESGRESVQQACVSVGFPIVQSVTDVIEMELVMTERRVRFSIEDEPESDARSEIRVQMQEELEDLYAAQEAGIAFILGHSHVRAKQGSSVLKKLALNFGYNFLRRNCRGPDVALKVPPVSLLEVGMVYIV*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain