|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT3G56290 | AT | Annotation by Michelle Graham. TAIR10: unknown protein; Has 39 Blast hits to 39 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr3:20878743-20879541 REVERSE LENGTH=173 | SoyBase | E_val: 4.00E-28 | ISS |
| GO:0009658 | GO-bp | Annotation by Michelle Graham. GO Biological Process: chloroplast organization | SoyBase | N/A | ISS |
| GO:0010264 | GO-bp | Annotation by Michelle Graham. GO Biological Process: myo-inositol hexakisphosphate biosynthetic process | SoyBase | N/A | ISS |
| GO:0045893 | GO-bp | Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent | SoyBase | N/A | ISS |
| GO:0005739 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion | SoyBase | N/A | ISS |
| GO:0003674 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: molecular function | SoyBase | N/A | ISS |
| UniRef100_Q00SR8 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: WGS project CAID00000000 data, contig chromosome 18 n=1 Tax=Ostreococcus tauri RepID=Q00SR8_OSTTA | SoyBase | E_val: 2.00E-06 | ISS |
| UniRef100_UPI0002337705 | UniRef | Annotation by Michelle Graham. Best UniRef hit: UPI0002337705 related cluster n=1 Tax=unknown RepID=UPI0002337705 | SoyBase | E_val: 5.00E-47 | ISS |
|
Glyma01g09948 not represented in the dataset |
Glyma01g09948 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.01g070800 | Wm82.a2.v1 | IGC | As supplied by JGI |
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma01g09948.1 sequence type=CDS gene model=Glyma01g09948 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGAAATTCAGAGTTTCAGCTAAACAAGAGAAGCAAGAAGAGAAGAAAAAGCAATCTTTGTTCAACAGTGTGACTAAAGCTCTTGATTTTTCTCAAGTGAGATCTGCTGAGGATGCTCAGCTTATAGAAGAGGCTAGAGAAGCTACAAGATCAGGTGAAAGGATGAGTAGGGAACAATATGGAGCTCTTAGAAGGAAAATTGGTGGTACATACAAGGATTTTTTCAAATCTTACGTTGAAGGTACAAAATAG
>Glyma01g09948.1 sequence type=predicted peptide gene model=Glyma01g09948 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MKFRVSAKQEKQEEKKKQSLFNSVTKALDFSQVRSAEDAQLIEEAREATRSGERMSREQYGALRRKIGGTYKDFFKSYVEGTK*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||