SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma01g09948

Feature Type:gene_model
Chromosome:Gm01
Start:12598149
stop:12598766
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma01g09948
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G56290AT Annotation by Michelle Graham. TAIR10: unknown protein; Has 39 Blast hits to 39 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr3:20878743-20879541 REVERSE LENGTH=173 SoyBaseE_val: 4.00E-28ISS
GO:0009658GO-bp Annotation by Michelle Graham. GO Biological Process: chloroplast organization SoyBaseN/AISS
GO:0010264GO-bp Annotation by Michelle Graham. GO Biological Process: myo-inositol hexakisphosphate biosynthetic process SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
UniRef100_Q00SR8UniRef Annotation by Michelle Graham. Most informative UniRef hit: WGS project CAID00000000 data, contig chromosome 18 n=1 Tax=Ostreococcus tauri RepID=Q00SR8_OSTTA SoyBaseE_val: 2.00E-06ISS
UniRef100_UPI0002337705UniRef Annotation by Michelle Graham. Best UniRef hit: UPI0002337705 related cluster n=1 Tax=unknown RepID=UPI0002337705 SoyBaseE_val: 5.00E-47ISS

Expression Patterns of Glyma01g09948
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma01g09948 not represented in the dataset
Glyma01g09948 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma01g09948 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.01g070800 Wm82.a2.v1IGC As supplied by JGI

References for Glyma01g09948
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma01g09948
>Glyma01g09948.1   sequence type=CDS   gene model=Glyma01g09948   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAATTCAGAGTTTCAGCTAAACAAGAGAAGCAAGAAGAGAAGAAAAAGCAATCTTTGTTCAACAGTGTGACTAAAGCTCTTGATTTTTCTCAAGTGAGATCTGCTGAGGATGCTCAGCTTATAGAAGAGGCTAGAGAAGCTACAAGATCAGGTGAAAGGATGAGTAGGGAACAATATGGAGCTCTTAGAAGGAAAATTGGTGGTACATACAAGGATTTTTTCAAATCTTACGTTGAAGGTACAAAATAG
Predicted protein sequences of Glyma01g09948
>Glyma01g09948.1   sequence type=predicted peptide   gene model=Glyma01g09948   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKFRVSAKQEKQEEKKKQSLFNSVTKALDFSQVRSAEDAQLIEEAREATRSGERMSREQYGALRRKIGGTYKDFFKSYVEGTK*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo