SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma01g09620

Feature Type:gene_model
Chromosome:Gm01
Start:11916862
stop:11920298
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma01g09620
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G18450AT Annotation by Michelle Graham. TAIR10: actin-related protein 4 | chr1:6348199-6351766 FORWARD LENGTH=441 SoyBaseE_val: 7.00E-44ISS
GO:0000003GO-bp Annotation by Michelle Graham. GO Biological Process: reproduction SoyBaseN/AISS
GO:0000398GO-bp Annotation by Michelle Graham. GO Biological Process: mRNA splicing, via spliceosome SoyBaseN/AISS
GO:0006306GO-bp Annotation by Michelle Graham. GO Biological Process: DNA methylation SoyBaseN/AISS
GO:0006312GO-bp Annotation by Michelle Graham. GO Biological Process: mitotic recombination SoyBaseN/AISS
GO:0006325GO-bp Annotation by Michelle Graham. GO Biological Process: chromatin organization SoyBaseN/AISS
GO:0006342GO-bp Annotation by Michelle Graham. GO Biological Process: chromatin silencing SoyBaseN/AISS
GO:0006346GO-bp Annotation by Michelle Graham. GO Biological Process: methylation-dependent chromatin silencing SoyBaseN/AISS
GO:0007131GO-bp Annotation by Michelle Graham. GO Biological Process: reciprocal meiotic recombination SoyBaseN/AISS
GO:0007267GO-bp Annotation by Michelle Graham. GO Biological Process: cell-cell signaling SoyBaseN/AISS
GO:0009560GO-bp Annotation by Michelle Graham. GO Biological Process: embryo sac egg cell differentiation SoyBaseN/AISS
GO:0009616GO-bp Annotation by Michelle Graham. GO Biological Process: virus induced gene silencing SoyBaseN/AISS
GO:0009640GO-bp Annotation by Michelle Graham. GO Biological Process: photomorphogenesis SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0009845GO-bp Annotation by Michelle Graham. GO Biological Process: seed germination SoyBaseN/AISS
GO:0009855GO-bp Annotation by Michelle Graham. GO Biological Process: determination of bilateral symmetry SoyBaseN/AISS
GO:0009909GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of flower development SoyBaseN/AISS
GO:0009933GO-bp Annotation by Michelle Graham. GO Biological Process: meristem structural organization SoyBaseN/AISS
GO:0010014GO-bp Annotation by Michelle Graham. GO Biological Process: meristem initiation SoyBaseN/AISS
GO:0010050GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative phase change SoyBaseN/AISS
GO:0010073GO-bp Annotation by Michelle Graham. GO Biological Process: meristem maintenance SoyBaseN/AISS
GO:0010090GO-bp Annotation by Michelle Graham. GO Biological Process: trichome morphogenesis SoyBaseN/AISS
GO:0010162GO-bp Annotation by Michelle Graham. GO Biological Process: seed dormancy process SoyBaseN/AISS
GO:0010182GO-bp Annotation by Michelle Graham. GO Biological Process: sugar mediated signaling pathway SoyBaseN/AISS
GO:0010228GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem SoyBaseN/AISS
GO:0010267GO-bp Annotation by Michelle Graham. GO Biological Process: production of ta-siRNAs involved in RNA interference SoyBaseN/AISS
GO:0010638GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of organelle organization SoyBaseN/AISS
GO:0016246GO-bp Annotation by Michelle Graham. GO Biological Process: RNA interference SoyBaseN/AISS
GO:0016567GO-bp Annotation by Michelle Graham. GO Biological Process: protein ubiquitination SoyBaseN/AISS
GO:0016572GO-bp Annotation by Michelle Graham. GO Biological Process: histone phosphorylation SoyBaseN/AISS
GO:0019915GO-bp Annotation by Michelle Graham. GO Biological Process: lipid storage SoyBaseN/AISS
GO:0031048GO-bp Annotation by Michelle Graham. GO Biological Process: chromatin silencing by small RNA SoyBaseN/AISS
GO:0033044GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of chromosome organization SoyBaseN/AISS
GO:0035196GO-bp Annotation by Michelle Graham. GO Biological Process: production of miRNAs involved in gene silencing by miRNA SoyBaseN/AISS
GO:0048235GO-bp Annotation by Michelle Graham. GO Biological Process: pollen sperm cell differentiation SoyBaseN/AISS
GO:0048573GO-bp Annotation by Michelle Graham. GO Biological Process: photoperiodism, flowering SoyBaseN/AISS
GO:0048574GO-bp Annotation by Michelle Graham. GO Biological Process: long-day photoperiodism, flowering SoyBaseN/AISS
GO:0050826GO-bp Annotation by Michelle Graham. GO Biological Process: response to freezing SoyBaseN/AISS
GO:0051567GO-bp Annotation by Michelle Graham. GO Biological Process: histone H3-K9 methylation SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005730GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleolus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005200GO-mf Annotation by Michelle Graham. GO Molecular Function: structural constituent of cytoskeleton SoyBaseN/AISS
PTHR11937Panther ACTIN JGI ISS
PTHR11937:SF32Panther ACTIN-RELATED M1 JGI ISS
PF00022PFAM Actin JGI ISS
UniRef100_B9RE21UniRef Annotation by Michelle Graham. Most informative UniRef hit: Protein binding protein, putative n=1 Tax=Ricinus communis RepID=B9RE21_RICCO SoyBaseE_val: 5.00E-44ISS
UniRef100_I1JMM6UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1JMM6_SOYBN SoyBaseE_val: 3.00E-49ISS

Expression Patterns of Glyma01g09620
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma01g09620 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma01g09620
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma01g09620
>Glyma01g09620.1   sequence type=CDS   gene model=Glyma01g09620   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCCCATTTATGCTTCTTTTGTAACCATCTTGGAAAGCCCTTGATGAGGATTCCAAACAGCCCCCACGCCATTAACTTCCCTTTGAATGTCACTTGTGTTGATTTTCAACTCCTCTTGGTCAATTTTCTGGATAAGGATTTATGTTGTTGTTGGTCGTTCTTTTCCTATTCTAGTTTTGACCATTTTTCCATTGGAATGACTATTGATTGGGTGTGCTTTCTTTTTTTTTTGCATCCTATGCTTCTTGCAGAGCCTTCTTCTAACTCTCAACAACAGAGAGAAAGGACAGTAGAGCTTATGTTTGAGAAGTACAAAGCACCTGCATTGTTTTTGGTGAAGAATGTTGTTCTAACTTCTTTTGCATCAGGGCGTGCTACGTCATTAGTTGTTGATGGTGGTGGAGGATCAATTACAGTTGCACCAGTACATGATGGTTATCACAAGTTGATTTTGCTTGGAGGAGAATTTCTTACAGATTGCTTGATGAAAAGCTTGGAAAGCAAGGGTATTATGGAGGGCACCATACTTGTTCTGTTGTTTTCATTAAACTTTGAACATGGCCAGGATGAGGTTCCATCCCATGATTTCTGGATGATTTTAGTACTTCATTTTTCTCATCTCTTTTATTTGAGTTATACTGCTGCTAAATTAGGTTCTTTCTCTCTGTATGCATATGATGGTTTGACAATTGAAATTGGAGCTGACATATTTAAGATTCCAGAACACTCAAAAACTGTCTTAGTTGGTATGACATTTTAA
Predicted protein sequences of Glyma01g09620
>Glyma01g09620.1   sequence type=predicted peptide   gene model=Glyma01g09620   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSHLCFFCNHLGKPLMRIPNSPHAINFPLNVTCVDFQLLLVNFLDKDLCCCWSFFSYSSFDHFSIGMTIDWVCFLFFLHPMLLAEPSSNSQQQRERTVELMFEKYKAPALFLVKNVVLTSFASGRATSLVVDGGGGSITVAPVHDGYHKLILLGGEFLTDCLMKSLESKGIMEGTILVLLFSLNFEHGQDEVPSHDFWMILVLHFSHLFYLSYTAAKLGSFSLYAYDGLTIEIGADIFKIPEHSKTVLVGMTF*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo