Glyma01g09251 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma01g09251

Feature Type:	gene_model
Chromosome:	Gm01
Start:	11062434
stop:	11064112
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma01g09251

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
UniRef100_UPI000233761B	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233761B related cluster n=1 Tax=unknown RepID=UPI000233761B	SoyBase	E_val: 1.00E-50	ISS

Expression Patterns of Glyma01g09251

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma01g09251 not represented in the dataset	Glyma01g09251 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma01g09251

Paralog	Evidence	Comments
Glyma02g13740	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma01g09251 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.01g067700	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma01g09251

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma01g09251

Limit To All Plant Sequences

>Glyma01g09251.1   sequence type=CDS   gene model=Glyma01g09251   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGTGCTAATCAAGAACACTGCTTGTGTTGTGCTTGTATTTCTTTCTGCTGCCTGGCTATCCACTGCTCGCATGAACCCTAAAAGTGTTGCTGTTAGTGAAATTTCATATATAAAGGCAACGATTGCATTTAGTGTTCCAAAAAGTACTACGGTGAAAAGCCTGGCTGCAATTGATGAAGGTAACTTGAACAAACTAAGTGAGAAGCTTCTTATGAGCAAATCTGGGAAGGTTATCTCTGCTCCCATCCTCCTCTAA

Predicted protein sequences of Glyma01g09251

Limit To All Plant Sequences

>Glyma01g09251.1   sequence type=predicted peptide   gene model=Glyma01g09251   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MVLIKNTACVVLVFLSAAWLSTARMNPKSVAVSEISYIKATIAFSVPKSTTVKSLAAIDEGNLNKLSEKLLMSKSGKVISAPILL*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain