Glyma01g09040 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma01g09040): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma01g09040): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma01g09040

Feature Type:	gene_model
Chromosome:	Gm01
Start:	10601639
stop:	10602621
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma01g09040

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G80460	AT	Annotation by Michelle Graham. TAIR10: Actin-like ATPase superfamily protein \| chr1:30246960-30249055 REVERSE LENGTH=522	SoyBase	E_val: 1.00E-82	ISS
GO:0002237	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to molecule of bacterial origin	SoyBase	N/A	ISS
GO:0005975	GO-bp	Annotation by Michelle Graham. GO Biological Process: carbohydrate metabolic process	SoyBase	N/A	ISS
GO:0006072	GO-bp	Annotation by Michelle Graham. GO Biological Process: glycerol-3-phosphate metabolic process	SoyBase	N/A	ISS
GO:0006635	GO-bp	Annotation by Michelle Graham. GO Biological Process: fatty acid beta-oxidation	SoyBase	N/A	ISS
GO:0009617	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to bacterium	SoyBase	N/A	ISS
GO:0010188	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to microbial phytotoxin	SoyBase	N/A	ISS
GO:0019563	GO-bp	Annotation by Michelle Graham. GO Biological Process: glycerol catabolic process	SoyBase	N/A	ISS
GO:0042742	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response to bacterium	SoyBase	N/A	ISS
GO:0080167	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to karrikin	SoyBase	N/A	ISS
GO:0005739	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion	SoyBase	N/A	ISS
GO:0005829	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosol	SoyBase	N/A	ISS
GO:0004370	GO-mf	Annotation by Michelle Graham. GO Molecular Function: glycerol kinase activity	SoyBase	N/A	ISS
GO:0016773	GO-mf	Annotation by Michelle Graham. GO Molecular Function: phosphotransferase activity, alcohol group as acceptor	SoyBase	N/A	ISS
GO:0019200	GO-mf	Annotation by Michelle Graham. GO Molecular Function: carbohydrate kinase activity	SoyBase	N/A	ISS
PTHR10196	Panther	XYLULOSE KINASE	JGI		ISS
PTHR10196:SF9	Panther	SUGAR KINASE-RELATED	JGI		ISS
PF02782	PFAM	FGGY family of carbohydrate kinases, C-terminal domain	JGI		ISS
UniRef100_Q6RUF8	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Glycerol kinase n=1 Tax=Glycine max RepID=Q6RUF8_SOYBN	SoyBase	E_val: 6.00E-95	ISS
UniRef100_UPI0002337614	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI0002337614 related cluster n=1 Tax=unknown RepID=UPI0002337614	SoyBase	E_val: 1.00E-129	ISS

Expression Patterns of Glyma01g09040

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma01g09040 not represented in the dataset	Glyma01g09040 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma01g09040 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.01g066700	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma01g09040

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma01g09040

Limit To All Plant Sequences

>Glyma01g09040.1   sequence type=CDS   gene model=Glyma01g09040   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCCAACAAGGTCTAACTATCATGTGCCATCCTATAGACAATGCTACCAGTGTGGAATGGATGAACTCCAGTTTGCTATCACCGGAGATGCAGTGCAGTGGCTTAGAGACAGTCTTGGCATCATTTCTAGTGCTTCAAAGATAGAGGAGATGGCATTACAGGTTGAATCCACTGGTGGGGTTTACTTTGTTCCTGCTTTTAATGGATTGTTTGCTCCATGGTGGCGTGAGGATGCTCGTAGCGTTTGTATTGGAATAACAAGGTTTACAAGCAAAGCTCACATTGCTCGAGCTACGCTCGAGAGCATGTGTTTCCAAGTGAAAGATGTCTTGGATTCAATGCATAAAGATTCAGGAGAAAGTGAATCTCGAAAGAATTTTTTGCTTAGATGTTCATCATATTTGGTGGGATGTCCAGCAATTAGACCTACTGACATAGAGACAACAACACTTGGAGCAGCCTATACTGTAGGATTAGCTATTGGGATTTGGAAAGAAGATTATCTTTTCAATACTAAGGACAAGTTGAAGAATGCTAATGTTTTCCGCCCCTTAATGACTGAGGAATTAAGGAAAAAGAAAGTGGCCTCTTGGTGCAAAGCTGTTAGTAAAACTTTCGACTTAGCGGATCTTTTTCTTTGA

Predicted protein sequences of Glyma01g09040

Limit To All Plant Sequences

>Glyma01g09040.1   sequence type=predicted peptide   gene model=Glyma01g09040   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MPTRSNYHVPSYRQCYQCGMDELQFAITGDAVQWLRDSLGIISSASKIEEMALQVESTGGVYFVPAFNGLFAPWWREDARSVCIGITRFTSKAHIARATLESMCFQVKDVLDSMHKDSGESESRKNFLLRCSSYLVGCPAIRPTDIETTTLGAAYTVGLAIGIWKEDYLFNTKDKLKNANVFRPLMTEELRKKKVASWCKAVSKTFDLADLFL*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain