SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma01g08760): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma01g08760): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma01g08760

Feature Type:gene_model
Chromosome:Gm01
Start:10355583
stop:10357514
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G69940AT Annotation by Michelle Graham. TAIR10: Pectin lyase-like superfamily protein | chr1:26343549-26344971 REVERSE LENGTH=361 SoyBaseE_val: 2.00E-151ISS
GO:0009860GO-bp Annotation by Michelle Graham. GO Biological Process: pollen tube growth SoyBaseN/AISS
GO:0042545GO-bp Annotation by Michelle Graham. GO Biological Process: cell wall modification SoyBaseN/AISS
GO:0005576GO-cc Annotation by Michelle Graham. GO Cellular Compartment: extracellular region SoyBaseN/AISS
GO:0005618GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cell wall SoyBaseN/AISS
GO:0005783GO-cc Annotation by Michelle Graham. GO Cellular Compartment: endoplasmic reticulum SoyBaseN/AISS
GO:0005794GO-cc Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus SoyBaseN/AISS
GO:0009505GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plant-type cell wall SoyBaseN/AISS
GO:0090406GO-cc Annotation by Michelle Graham. GO Cellular Compartment: pollen tube SoyBaseN/AISS
GO:0030599GO-mf Annotation by Michelle Graham. GO Molecular Function: pectinesterase activity SoyBaseN/AISS
PTHR22931Panther PHOSPHOENOLPYRUVATE DIKINASE-RELATED JGI ISS
PTHR22931:SF5Panther METHYLESTERASE INHIBITOR-RELATED JGI ISS
PF01095PFAM Pectinesterase JGI ISS
UniRef100_B9RA18UniRef Annotation by Michelle Graham. Most informative UniRef hit: Pectinesterase n=1 Tax=Ricinus communis RepID=B9RA18_RICCO SoyBaseE_val: 3.00E-159ISS
UniRef100_I1J659UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1J659_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma01g08760 not represented in the dataset

Glyma01g08760 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.01g066300 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma01g08760.1   sequence type=CDS   gene model=Glyma01g08760   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTTCAAGAACTATATGTTTTACCATTCAAGTGACTCTTGTAGTAGCTTTTCTAACAACAAAGGTTGTTTTATCTGATGACACTGTGCCAATTCCCGCGAACAAAGCACAATTAGGTGAATGGTATAATACTAATGTGGGGCCTTTAGATCAAAGAAAGAGCACCGTGGACCCAGCATTGGTGACTGCTGAAGAAGGCGCTAAGGTTGTAAAGGTGATGCAAGATGGCAGTGGGGAATTCAAGACCATCACTGATGCCATTAAAAGTATACCTAGTGGGAACACTAAGCGTGTAATTATTTACATTGGAGCTGGAAATTATAATGAGAAAATCAAAATTGAGAAGACAAAGCCTTTTGTCACCTTGTATGGGGTACCAGAGAAAATGCCAAACTTGACTTTTGGGGGCACTGCACAACAATATGGCACTGTTGATAGTGCTACATTGATTGTTGAATCAGATTATTTTGTGGCAGCTAACATCATGATCTCGAACACTGCACCGAGACCTGATCCAAAAACGCCAGGAGGTCAAGCAGTGGCATTGCGTATTTCGGGTGACAAAGCAGCATTTTATAATTGCAAGATGTATGGATTCCAGGACACAATTTGCGATGATAGGAATAGACATTTTTTCAAAGACTGCTTAATTCAAGGCACCATGGATTATATTTTTGGAAGTGGGAAGTCACTATATGTGAGTACTGAGTTAAGAACGCTTGGCGACAATGGGATTACTGTTATAGTGGCACAAGCAAGGAAAAGCGAGACAGAGGACAATGCCTACTCATTTGTACATTGTGACGTTACTGGAACTGGGACTGGCACTTTCTTGGGGAGAGCATGGATGTCTCATCCTAGAGTGGTCTTTGCATACAGCAACATGAGTGACATTGTAAATAAATTAGGGTGGAGTAACAACAATCACCCTGAACATGACAAAACTGTTCGTTTTGGAGAGTATCAGAACTCGGGACCTGGTGCAGACCCCAAAGGGCGTGCTACTATAACTAAGCAACTAAGTGAAAGGGAGGTTAAACCTTACATAACACTTGCGATGATTGAAGGCTCCAAATGGCTACTTCCTCCTCCAACTCCCAAGGTTTAA

>Glyma01g08760.1   sequence type=predicted peptide   gene model=Glyma01g08760   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASRTICFTIQVTLVVAFLTTKVVLSDDTVPIPANKAQLGEWYNTNVGPLDQRKSTVDPALVTAEEGAKVVKVMQDGSGEFKTITDAIKSIPSGNTKRVIIYIGAGNYNEKIKIEKTKPFVTLYGVPEKMPNLTFGGTAQQYGTVDSATLIVESDYFVAANIMISNTAPRPDPKTPGGQAVALRISGDKAAFYNCKMYGFQDTICDDRNRHFFKDCLIQGTMDYIFGSGKSLYVSTELRTLGDNGITVIVAQARKSETEDNAYSFVHCDVTGTGTGTFLGRAWMSHPRVVFAYSNMSDIVNKLGWSNNNHPEHDKTVRFGEYQNSGPGADPKGRATITKQLSEREVKPYITLAMIEGSKWLLPPPTPKV*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo