Glyma01g08745 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma01g08745): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma01g08745): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma01g08745

Feature Type:	gene_model
Chromosome:	Gm01
Start:	10293655
stop:	10294541
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma01g08745

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G59120	AT	Annotation by Michelle Graham. TAIR10: subtilase 4.13 \| chr5:23864897-23868020 REVERSE LENGTH=732	SoyBase	E_val: 1.00E-86	ISS
GO:0006508	GO-bp	Annotation by Michelle Graham. GO Biological Process: proteolysis	SoyBase	N/A	ISS
GO:0008152	GO-bp	Annotation by Michelle Graham. GO Biological Process: metabolic process	SoyBase	N/A	ISS
GO:0043086	GO-bp	Annotation by Michelle Graham. GO Biological Process: negative regulation of catalytic activity	SoyBase	N/A	ISS
GO:0048441	GO-bp	Annotation by Michelle Graham. GO Biological Process: petal development	SoyBase	N/A	ISS
GO:0048443	GO-bp	Annotation by Michelle Graham. GO Biological Process: stamen development	SoyBase	N/A	ISS
GO:0005576	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: extracellular region	SoyBase	N/A	ISS
GO:0005618	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cell wall	SoyBase	N/A	ISS
GO:0004252	GO-mf	Annotation by Michelle Graham. GO Molecular Function: serine-type endopeptidase activity	SoyBase	N/A	ISS
GO:0042802	GO-mf	Annotation by Michelle Graham. GO Molecular Function: identical protein binding	SoyBase	N/A	ISS
PTHR10795	Panther	SUBTILISIN/KEXIN-RELATED SERINE PROTEASE	JGI		ISS
PTHR10795:SF17	Panther	gb def: possible protease [sinorhizobium meliloti]	JGI		ISS
PF00082	PFAM	Subtilase family	JGI		ISS
UniRef100_I1MZ83	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MZ83_SOYBN	SoyBase	E_val: 4.00E-164	ISS
UniRef100_Q9ZTT3	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Subtilisin-like protease C1 n=1 Tax=Glycine max RepID=Q9ZTT3_SOYBN	SoyBase	E_val: 1.00E-159	ISS

Expression Patterns of Glyma01g08745

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma01g08745 not represented in the dataset	Glyma01g08745 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma01g08745 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma01g08745

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma01g08745

Limit To All Plant Sequences

>Glyma01g08745.1   sequence type=CDS   gene model=Glyma01g08745   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
GGACATGATAGAGTTGTAGTTGTCTTTCCTAATAAAAAGAAGCAACTCCATACAACAAGGTCATGGGATTTTATTGGCTTTCCACTACAAGCAAATAGAGCACCAACTGAAAGTGATGTCATCATTGCAGTACTTGACTCTGTAATTTGGCGAGAATCCGAGAGCTTCAATGACAAAGGATTTGGTCCACCACCAAGTAAATGGAAGGGCACCTGCCAAACTTCTAAAAATTTCACATGCAATAGTAAAATCATTGGGGCTAAGATTTACAAAGCTGGTGGATTTTTTAGCGATGATGATCCAAAATCTGTGAGGGATATAGATGGTCATGGCACTTATGTAGCATCAACAGCAGCTGGGAACCCAGTTAGCACAACTAGCATGTTAGGCCTTGGTCGAGGAACACCAAGAGGTGCTGCAACAAAAGCATGCATTGTTGTGTATAAAGTGTGTTGGTTTGATGGTTGTTCTGATGCAGACATACTTGCTGCATTTGATGATGCAATTGCAGATGGGGTTGACATAATAACAGTTTCTCTTGGAGGGTTCAGTGATGAAAACTACTTTAGAGATGTAATAGCCATTGGAGCATTTCATGCTATGAGAAATGGAGTGTTGACAGTAACTTCCGCAGGAAACAATGGTCCACGACCTTCCTCCCTATCCAACTTTTTGCCTTGGTCAATTACTGTGGCTGCTAGTACCATAGACAGGAAGTTTGTTACCAAGGTTGAATTAGGTAACAGGATCACCTATGAGGTAAATTACCTTCTCTATCCTATTTGA

Predicted protein sequences of Glyma01g08745

Limit To All Plant Sequences

>Glyma01g08745.1   sequence type=predicted peptide   gene model=Glyma01g08745   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
GHDRVVVVFPNKKKQLHTTRSWDFIGFPLQANRAPTESDVIIAVLDSVIWRESESFNDKGFGPPPSKWKGTCQTSKNFTCNSKIIGAKIYKAGGFFSDDDPKSVRDIDGHGTYVASTAAGNPVSTTSMLGLGRGTPRGAATKACIVVYKVCWFDGCSDADILAAFDDAIADGVDIITVSLGGFSDENYFRDVIAIGAFHAMRNGVLTVTSAGNNGPRPSSLSNFLPWSITVAASTIDRKFVTKVELGNRITYEVNYLLYPI*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain