Glyma01g06947 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma01g06947): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma01g06947): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma01g06947

Feature Type:	gene_model
Chromosome:	Gm01
Start:	7435647
stop:	7436810
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma01g06947

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G52100	AT	Annotation by Michelle Graham. TAIR10: Dihydrodipicolinate reductase, bacterial/plant \| chr5:21170203-21172107 FORWARD LENGTH=298	SoyBase	E_val: 1.00E-56	ISS
GO:0009089	GO-bp	Annotation by Michelle Graham. GO Biological Process: lysine biosynthetic process via diaminopimelate	SoyBase	N/A	ISS
GO:0009773	GO-bp	Annotation by Michelle Graham. GO Biological Process: photosynthetic electron transport in photosystem I	SoyBase	N/A	ISS
GO:0009965	GO-bp	Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis	SoyBase	N/A	ISS
GO:0010103	GO-bp	Annotation by Michelle Graham. GO Biological Process: stomatal complex morphogenesis	SoyBase	N/A	ISS
GO:0010207	GO-bp	Annotation by Michelle Graham. GO Biological Process: photosystem II assembly	SoyBase	N/A	ISS
GO:0016556	GO-bp	Annotation by Michelle Graham. GO Biological Process: mRNA modification	SoyBase	N/A	ISS
GO:0019684	GO-bp	Annotation by Michelle Graham. GO Biological Process: photosynthesis, light reaction	SoyBase	N/A	ISS
GO:0030154	GO-bp	Annotation by Michelle Graham. GO Biological Process: cell differentiation	SoyBase	N/A	ISS
GO:0042742	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response to bacterium	SoyBase	N/A	ISS
GO:0045893	GO-bp	Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0055114	GO-bp	Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0009570	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma	SoyBase	N/A	ISS
GO:0000166	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nucleotide binding	SoyBase	N/A	ISS
GO:0008839	GO-mf	Annotation by Michelle Graham. GO Molecular Function: dihydrodipicolinate reductase activity	SoyBase	N/A	ISS
GO:0070402	GO-mf	Annotation by Michelle Graham. GO Molecular Function: NADPH binding	SoyBase	N/A	ISS
PTHR20836	Panther	DIHYDRODIPICOLINATE REDUCTASE	JGI		ISS
PF01113	PFAM	Dihydrodipicolinate reductase, N-terminus	JGI		ISS
UniRef100_G7IAQ3	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Dihydrodipicolinate reductase n=1 Tax=Medicago truncatula RepID=G7IAQ3_MEDTR	SoyBase	E_val: 2.00E-62	ISS
UniRef100_I1LDU8	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LDU8_SOYBN	SoyBase	E_val: 1.00E-70	ISS

Expression Patterns of Glyma01g06947

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma01g06947 not represented in the dataset	Glyma01g06947 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma01g06947 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma01g06947

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma01g06947

Limit To All Plant Sequences

>Glyma01g06947.1   sequence type=CDS   gene model=Glyma01g06947   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
GTTGTGATTAATGGAGCAACCAAGGAAATAGGAAAGGTAGCAGTAGTGGCAGTGACTAAGGCATGTAGAATAGAGGTAGCAGGAACGGTGGATACTTGTCATATTGGGGAAAACATTAGAAAGATATGTGGCACGGAAGAGCTCCTTCAAATACCCATCATAAATGACCTTACTATGATTTTGGGCTCCATATCTCAGTCCAAGGTAGCAAGAGTTGTAGTTGATTTCACTGACCCTTCCTCTGTATATGACAATACATGTTTCATAGCAAATGAAAACAACTTCGACTACACGGTAGCTGCACTATCTGCATTTTGCGACAAGGCCAACATGGGTGTCTTGGTTGCACCAAACCTTTCCATCGGATCAATATTATTGCAACAACTTGCGATTTTAGCTTCTTTCCATTACAACAATATCGAAATTGTGGAATCTAGGGCCAATGCAAATGTAAGATTTTTTTATGTTTAG

Predicted protein sequences of Glyma01g06947

Limit To All Plant Sequences

>Glyma01g06947.1   sequence type=predicted peptide   gene model=Glyma01g06947   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
VVINGATKEIGKVAVVAVTKACRIEVAGTVDTCHIGENIRKICGTEELLQIPIINDLTMILGSISQSKVARVVVDFTDPSSVYDNTCFIANENNFDYTVAALSAFCDKANMGVLVAPNLSIGSILLQQLAILASFHYNNIEIVESRANANVRFFYV*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain