Report for Sequence Feature Glyma01g05770
Feature Type: gene_model
Chromosome: Gm01
Start: 5507146
stop: 5510888
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma01g05770
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT5G22260 AT
Annotation by Michelle Graham. TAIR10: RING/FYVE/PHD zinc finger superfamily protein | chr5:7367707-7370192 REVERSE LENGTH=672
SoyBase E_val: 8.00E-111 ISS
GO:0006355 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent
SoyBase N/A ISS
GO:0009556 GO-bp
Annotation by Michelle Graham. GO Biological Process: microsporogenesis
SoyBase N/A ISS
GO:0009846 GO-bp
Annotation by Michelle Graham. GO Biological Process: pollen germination
SoyBase N/A ISS
GO:0010208 GO-bp
Annotation by Michelle Graham. GO Biological Process: pollen wall assembly
SoyBase N/A ISS
GO:0045893 GO-bp
Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent
SoyBase N/A ISS
GO:0048655 GO-bp
Annotation by Michelle Graham. GO Biological Process: tapetal layer morphogenesis
SoyBase N/A ISS
GO:0055046 GO-bp
Annotation by Michelle Graham. GO Biological Process: microgametogenesis
SoyBase N/A ISS
GO:0071367 GO-bp
Annotation by Michelle Graham. GO Biological Process: cellular response to brassinosteroid stimulus
SoyBase N/A ISS
GO:0005634 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: nucleus
SoyBase N/A ISS
GO:0005739 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion
SoyBase N/A ISS
GO:0003677 GO-mf
Annotation by Michelle Graham. GO Molecular Function: DNA binding
SoyBase N/A ISS
GO:0003700 GO-mf
Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity
SoyBase N/A ISS
GO:0008270 GO-mf
Annotation by Michelle Graham. GO Molecular Function: zinc ion binding
SoyBase N/A ISS
PTHR16286 Panther
MIXED-LINEAGE LEUKEMIA 5, MLL5
JGI ISS
PTHR16286:SF4 Panther
SUBFAMILY NOT NAMED
JGI ISS
UniRef100_G7KF85 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Histone-lysine N-methyltransferase MLL5 n=1 Tax=Medicago truncatula RepID=G7KF85_MEDTR
SoyBase E_val: 1.00E-162 ISS
UniRef100_I1J5Q9 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1J5Q9_SOYBN
SoyBase E_val: 0 ISS
Expression Patterns of Glyma01g05770
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Gene model name correspondences to Glyma01g05770 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.01g047400 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma01g05770
Coding sequences of Glyma01g05770
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma01g05770.2 sequence type=CDS gene model=Glyma01g05770 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGGAAATGCCAATGTGGTCTTTTCAACATGAAGTTCATCACCACCCACCTTTACATATCTTGTTGTTTGTGATTGAAGAGCCAATAGAGGCAGCATTGAATCGTCACTGCAAGCATTGTCAATACGTTGGCTGGGGCAACCATTTCATTTGCAATAAGTATCACTTTGTGTTGCCCTCAAAGGAGGCACTGGGTACCTGCACAAGCTGTGATGCAATTACTACAACTAATAATGGTAAGTCCAAATTAATTGAATTACAGGGTCATATGATGCATGGTGTTTTTCACTCTAATGGATTCGGGCATTTGCTTTGTGTCAATGGATTGGAAATGGGTTCGAGTTTAGCTGGGAACCAGATCATGGAGTTTTGGAACCGTTTGTGCTACGGATTGCAAGCAAGTTTGAATGACATTTCACATAAGAGAGGAATGAAACTTAGACTTATGAATGGAATAGCATACAATGAGACATGGTTTGGCAGTTGGGGTTACAAATTTGGTCGAGGATGCTTTGGTGTAACTCAATCCATGTACCACAAGGCCATACAAGCAATAAGAAGCATGTCATTATACTTGATCATACACCACATTGCCAATTCTAGCCATGGCATTCCACTAATCTTCTCAAGGAACCAGACACTTTCAGATCAATCCCTAGTGACCCTTGGTGACCTATTTTGTTACATTTCCTATAAAACAAATGCCTTAGTTGAGACCAATTGTCGTTGGTCCCCTAAAAGGATTGAGATGGCAACAAGGGTTATTGTTGAGGCCTTGAAAAGAACAGAGTTTAAATGGGTTTCAAGACAAGAAGTTAGAGATGCTGCTCGTGCATACATTAGTGACACAAGTTTGGTAGATTTTGTGTTGAGATTAAAACCAATTATGAGGTCAGAATTTCTTTCAGCTATACCATTGGCAGCTAGGATAATTCTTGGCACTAAGTATTTTATTAAAGATTACTTTGGAGATATTCCTCACCAAGTTGAATTAGGCTCCGATGATAAACTCAACATTTATTGTACAATTTGGTTGAGAAACAATCAAATATGTGAAAGTGATATGAACAATGGTATAATGGATTGCACTTGTGGAACTATAGAAGATGATGGTGAGAGGATGGTCTCGTGTGATATTTGTGAAATTTGGCAACATACTAGGTGTGTTTGA
Predicted protein sequences of Glyma01g05770
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma01g05770.2 sequence type=predicted peptide gene model=Glyma01g05770 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MEMPMWSFQHEVHHHPPLHILLFVIEEPIEAALNRHCKHCQYVGWGNHFICNKYHFVLPSKEALGTCTSCDAITTTNNGKSKLIELQGHMMHGVFHSNGFGHLLCVNGLEMGSSLAGNQIMEFWNRLCYGLQASLNDISHKRGMKLRLMNGIAYNETWFGSWGYKFGRGCFGVTQSMYHKAIQAIRSMSLYLIIHHIANSSHGIPLIFSRNQTLSDQSLVTLGDLFCYISYKTNALVETNCRWSPKRIEMATRVIVEALKRTEFKWVSRQEVRDAARAYISDTSLVDFVLRLKPIMRSEFLSAIPLAARIILGTKYFIKDYFGDIPHQVELGSDDKLNIYCTIWLRNNQICESDMNNGIMDCTCGTIEDDGERMVSCDICEIWQHTRCV*