SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma01g04530

Feature Type:gene_model
Chromosome:Gm01
Start:4108621
stop:4111438
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma01g04530
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G70000AT Annotation by Michelle Graham. TAIR10: myb-like transcription factor family protein | chr1:26363674-26364635 REVERSE LENGTH=261 SoyBaseE_val: 2.00E-80ISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009723GO-bp Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus SoyBaseN/AISS
GO:0009733GO-bp Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus SoyBaseN/AISS
GO:0009737GO-bp Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus SoyBaseN/AISS
GO:0009739GO-bp Annotation by Michelle Graham. GO Biological Process: response to gibberellin stimulus SoyBaseN/AISS
GO:0009751GO-bp Annotation by Michelle Graham. GO Biological Process: response to salicylic acid stimulus SoyBaseN/AISS
GO:0009753GO-bp Annotation by Michelle Graham. GO Biological Process: response to jasmonic acid stimulus SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0080167GO-bp Annotation by Michelle Graham. GO Biological Process: response to karrikin SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003676GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
PTHR12374Panther TRANSCRIPTIONAL ADAPTOR 2 (ADA2)-RELATED JGI ISS
PF00249PFAM Myb-like DNA-binding domain JGI ISS
UniRef100_I1J5G9UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1J5G9_SOYBN SoyBaseE_val: 0ISS
UniRef100_Q0PJI4UniRef Annotation by Michelle Graham. Most informative UniRef hit: MYB transcription factor MYB138 n=1 Tax=Glycine max RepID=Q0PJI4_SOYBN SoyBaseE_val: 1.00E-168ISS

Expression Patterns of Glyma01g04530
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma01g04530
ParalogEvidenceComments
Glyma02g03020 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma01g04530 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.01g038600 Wm82.a2.v1IGC As supplied by JGI

References for Glyma01g04530
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma01g04530
>Glyma01g04530.1   sequence type=CDS   gene model=Glyma01g04530   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCTCGCACGTGCTCACAGTGCGGCAACAACGGCCACAACTCACGGACATGCACCGACGGTGGCGCCGCCGGGTCTCCGAGGGAGAACGGCATCATGCTGTTCGGCGTAAGAGTCATGACGGAAGCTAACTCCTCCTTCAGGAAGAGCGCCAGCATGAACAACCTCTCACAGTACGACGCGGAGTTCAACGCCGCCGACGCCGGCTACGCCTCCGACGACGTCGTTCACGCCTCCGGCCGCACGCGCGAGCGCAAGCGAGGTGTTCCTTGGACGGAGGAAGAGCATAGATTGTTCCTGTTAGGGTTACACAAAGTCGGAAAAGGAGATTGGAGAGGGATTTCTAGAAACTTCGTGAAAACTCGCACGCCTACTCAGGTCGCTAGTCACGCTCAGAAGTACTTTCTCCGCCGCCACAACCAGAATCGCCGCCGCCGGAGATCTAGCCTCTTCGACATCACCACCGATACGGTGATGGAATCTTCTACTATAATGGAAGAAGAACAAGTTCCGCCAGAGACGGTGGCGGCGCCTCTCCCCGCCGCATATCCGCCGTCGCATTACGGGGCTTTTGCCGGCGCGGGTTTTCCGATAGCTCCGGTGGTGTTGCCGGTGAGTGGCGAGAGACTAACCAAGCCGATCAGGCCGACGCCGATTTTGCCAGTGCCTCCGTCTTCGAAGATGGCTAATTTGAACTTGAAAGAGAAAGCTTCTCCGACAAATCTCATTGAGCCTTTGCCGTTGTCGTTGAATCTGCCATCGCCGACGCCGCGGTCTCAGGATCAGTCGTCGGCGAGTAGTGGGCACTCGTCACCGTCGTCGTCGTCATCGGCGGCAGCTTTTCAGGCTATGTCTGCAGCGAAGTTCGGCAGCGGCGGGGATAGTATCATCAGCGTTGCTTGA
Predicted protein sequences of Glyma01g04530
>Glyma01g04530.1   sequence type=predicted peptide   gene model=Glyma01g04530   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSRTCSQCGNNGHNSRTCTDGGAAGSPRENGIMLFGVRVMTEANSSFRKSASMNNLSQYDAEFNAADAGYASDDVVHASGRTRERKRGVPWTEEEHRLFLLGLHKVGKGDWRGISRNFVKTRTPTQVASHAQKYFLRRHNQNRRRRRSSLFDITTDTVMESSTIMEEEQVPPETVAAPLPAAYPPSHYGAFAGAGFPIAPVVLPVSGERLTKPIRPTPILPVPPSSKMANLNLKEKASPTNLIEPLPLSLNLPSPTPRSQDQSSASSGHSSPSSSSSAAAFQAMSAAKFGSGGDSIISVA*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo