SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma01g03530): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma01g03530): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma01g03530

Feature Type:gene_model
Chromosome:Gm01
Start:3043748
stop:3048064
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G10670AT Annotation by Michelle Graham. TAIR10: ATP-citrate lyase A-1 | chr1:3535787-3538098 FORWARD LENGTH=423 SoyBaseE_val: 0ISS
GO:0000271GO-bp Annotation by Michelle Graham. GO Biological Process: polysaccharide biosynthetic process SoyBaseN/AISS
GO:0006084GO-bp Annotation by Michelle Graham. GO Biological Process: acetyl-CoA metabolic process SoyBaseN/AISS
GO:0006085GO-bp Annotation by Michelle Graham. GO Biological Process: acetyl-CoA biosynthetic process SoyBaseN/AISS
GO:0006633GO-bp Annotation by Michelle Graham. GO Biological Process: fatty acid biosynthetic process SoyBaseN/AISS
GO:0007568GO-bp Annotation by Michelle Graham. GO Biological Process: aging SoyBaseN/AISS
GO:0009825GO-bp Annotation by Michelle Graham. GO Biological Process: multidimensional cell growth SoyBaseN/AISS
GO:0009911GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of flower development SoyBaseN/AISS
GO:0009932GO-bp Annotation by Michelle Graham. GO Biological Process: cell tip growth SoyBaseN/AISS
GO:0010025GO-bp Annotation by Michelle Graham. GO Biological Process: wax biosynthetic process SoyBaseN/AISS
GO:0010817GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of hormone levels SoyBaseN/AISS
GO:0015995GO-bp Annotation by Michelle Graham. GO Biological Process: chlorophyll biosynthetic process SoyBaseN/AISS
GO:0016117GO-bp Annotation by Michelle Graham. GO Biological Process: carotenoid biosynthetic process SoyBaseN/AISS
GO:0019252GO-bp Annotation by Michelle Graham. GO Biological Process: starch biosynthetic process SoyBaseN/AISS
GO:0019344GO-bp Annotation by Michelle Graham. GO Biological Process: cysteine biosynthetic process SoyBaseN/AISS
GO:0030244GO-bp Annotation by Michelle Graham. GO Biological Process: cellulose biosynthetic process SoyBaseN/AISS
GO:0043481GO-bp Annotation by Michelle Graham. GO Biological Process: anthocyanin accumulation in tissues in response to UV light SoyBaseN/AISS
GO:0045793GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of cell size SoyBaseN/AISS
GO:0045995GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of embryonic development SoyBaseN/AISS
GO:0048193GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi vesicle transport SoyBaseN/AISS
GO:0048366GO-bp Annotation by Michelle Graham. GO Biological Process: leaf development SoyBaseN/AISS
GO:0048767GO-bp Annotation by Michelle Graham. GO Biological Process: root hair elongation SoyBaseN/AISS
GO:0071555GO-bp Annotation by Michelle Graham. GO Biological Process: cell wall organization SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0009346GO-cc Annotation by Michelle Graham. GO Cellular Compartment: citrate lyase complex SoyBaseN/AISS
GO:0003878GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP citrate synthase activity SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
GO:0016874GO-mf Annotation by Michelle Graham. GO Molecular Function: ligase activity SoyBaseN/AISS
KOG1254 KOG ATP-citrate lyase JGI ISS
PTHR23118Panther ATP-CITRATE SYNTHASE JGI ISS
PF08442PFAM ATP-grasp domain JGI ISS
UniRef100_I1J574UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1J574_SOYBN SoyBaseE_val: 0ISS
UniRef100_Q93YH3UniRef Annotation by Michelle Graham. Most informative UniRef hit: ATP citrate lyase b-subunit n=1 Tax=Lupinus albus RepID=Q93YH3_LUPAL SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma01g03530 not represented in the dataset

Glyma01g03530 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma02g04120 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.01g028900 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma01g03530.1   sequence type=CDS   gene model=Glyma01g03530   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGCGTAAGAAGATCAGAGAGTATGACTCAAAGAGGTTGTTGAAGGAGCACTTTAAGAGACTTTCTGGCAAGGAGTTGCCGATCAAGTCTGCACAAATTACTGCATCAACTGATTTCACTGAGCTACAAGAGAAGGAACCCTGGCTTTCATCTTCTAAATTGGTTGTGAAACCTGACATGTTATTTGGAAAGCGTGGCAAAAGTGGTTTGGTTGCCTTAAATTTGGATTTTGCACAAGTTGTTTCGTTTGTGAAGGAGCGTCTTGGAAAAGAGGTTGAGATGAGTGGATGCAAAGGACCCATAACAACTTTCATTGTCGAACCTTTCATCCCACACAATGAAGAGTTTTACCTTAACATTGTCTCCGAGAGACTTGGGAACAGCATAAGCTTTTCAGAATGTGGAGGAATTGAAATTGAAGACAACTGGGATAAGGTTAAGACTGCATTTGTTCCAACAGGAGTGTCTCTTACGTCAGAAATTGTTGCCCCACTTGTTGCAACCCTTCCCTTGGAGATCAAGGGAGAAATTGAGGAGTTTCTCAAAGTGGTTTTCACTCTGTTTCAAGACCTGGATTTTACTTTCTTAGAGATGAATCCTTTCACATTGGTTGATGGAAAGCCTTATCCTTTGGATATGAGAGGCGAGCTAGATGACACTGCTGCTTTCAAGAACTTCAAGAAATGGGGAGACATTGAATTTCCACTGCCATTTGGAAGGGTTATGAGTGCCACCGAGTCTTTCATTCATGGATTAGATGAAAAGACAAGTGCATCCTTAAAATTCACAGTGTTGAACCCAAAGGGCCGAATTTGGACAATGGTAGCTGGGGGAGGTGCTAGTGTCATTTATGCTGATACGGTAGGAGATCTTGGCTTTGCATCTGAGCTTGGAAACTATGCTGAATACAGTGGTGCACCCAAAGAAGAGGAGGTCTTGCAGTACGCCAGAGTTGTAATTGATTGTGCAACTGCAAACCCTGATGACCAGAAGAGAGCTCTTGTGATAGGAGGAGGCATAGCCAACTTTACTGATGTTGCTGCCACATTTAGTGGTATAATTCGGGCATTGAAGGAGAAGGAGTCAAAATTGAAAGCAGCAAGGATGCACATCTTTGTGAGGAGAGGGGGTCCCAACTACCAGAAGGGTCTAGCTTTGATGCGAGCGCTTGGAGAGGATATTGGCATCCCCATTGAGGTTTATGGACCTGAAGCCACAATGACTGGTATATGCAAAGAGGCAATACAGTTCATTACTGCTGCCGCTTAA

>Glyma01g03530.1   sequence type=predicted peptide   gene model=Glyma01g03530   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MARKKIREYDSKRLLKEHFKRLSGKELPIKSAQITASTDFTELQEKEPWLSSSKLVVKPDMLFGKRGKSGLVALNLDFAQVVSFVKERLGKEVEMSGCKGPITTFIVEPFIPHNEEFYLNIVSERLGNSISFSECGGIEIEDNWDKVKTAFVPTGVSLTSEIVAPLVATLPLEIKGEIEEFLKVVFTLFQDLDFTFLEMNPFTLVDGKPYPLDMRGELDDTAAFKNFKKWGDIEFPLPFGRVMSATESFIHGLDEKTSASLKFTVLNPKGRIWTMVAGGGASVIYADTVGDLGFASELGNYAEYSGAPKEEEVLQYARVVIDCATANPDDQKRALVIGGGIANFTDVAATFSGIIRALKEKESKLKAARMHIFVRRGGPNYQKGLALMRALGEDIGIPIEVYGPEATMTGICKEAIQFITAAA*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo